ID: 915805671

View in Genome Browser
Species Human (GRCh38)
Location 1:158846665-158846687
Sequence TAGCATCTTGAATTTGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 205}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915805671 Original CRISPR TAGCATCTTGAATTTGGACA TGG (reversed) Intronic
902709959 1:18232083-18232105 AAGCATCCTCAAGTTGGACAGGG - Intronic
903441283 1:23389805-23389827 TAGCAGCTTGAAATTGGCCATGG - Intronic
904859679 1:33526272-33526294 TAGCATGGTGAATTGGAACATGG + Intronic
905187265 1:36205436-36205458 TGGCAGCTTGAAATTGGCCATGG - Intergenic
910504927 1:87939549-87939571 AAGCATCTTGCATTTGTACATGG + Intergenic
910509917 1:87992158-87992180 GAGCATCTTGGATTTAGAAAGGG - Intergenic
912489561 1:110054456-110054478 CAGCACTTTGATTTTGGACAGGG + Exonic
913197017 1:116465696-116465718 TTGCATTGTGATTTTGGACAGGG + Intergenic
913272275 1:117106079-117106101 TAGCATCTAGACTTAGGAAAGGG + Exonic
914473398 1:148003438-148003460 TAGTAAGTTGAAATTGGACATGG + Intergenic
914700429 1:150127662-150127684 TAGCTTTATGACTTTGGACAAGG - Intronic
915805671 1:158846665-158846687 TAGCATCTTGAATTTGGACATGG - Intronic
915808719 1:158883105-158883127 TGTCACCTTGAATTTGGACATGG - Intergenic
917767046 1:178231765-178231787 TAGAATGGTGAATTTGCACAAGG - Intronic
919892698 1:201987303-201987325 TAGCATTTAGAATTTAGAAATGG - Intronic
921454798 1:215357674-215357696 CACCATCTTGAAATTGGCCATGG - Intergenic
921576649 1:216843046-216843068 GATCATCATGAATTTGGACAAGG - Intronic
921949419 1:220914388-220914410 TGGCATGGTGAATTTGGGCATGG + Intergenic
1063568127 10:7190540-7190562 GAGCTTGTTGAATTTGGAGACGG - Intronic
1063644993 10:7870826-7870848 TAGCATCTTAAATATGGAGTGGG - Intronic
1063751250 10:8950441-8950463 TGGCATCATAAACTTGGACAAGG + Intergenic
1064229795 10:13520095-13520117 CTGGATCTGGAATTTGGACATGG - Intronic
1064766627 10:18681928-18681950 TAGCCTCCTAAATTTGTACAAGG + Intergenic
1067680349 10:48432261-48432283 TAGCATCTTGTATATGGGTAAGG + Intronic
1069546618 10:69333774-69333796 TAGCAACGTGAATGTGGACAGGG - Intronic
1073960611 10:108922849-108922871 TTGCATCTTGCATTTGCATAAGG - Intergenic
1074917752 10:117973940-117973962 CAGCATCTTGATCTTGGACTTGG - Intergenic
1075538018 10:123287527-123287549 TATCATCTTGATTTTGAAGATGG + Intergenic
1078557780 11:12344452-12344474 TAGTTTCTAGAATTTTGACAAGG - Intronic
1078965313 11:16333132-16333154 TACCTTCTTTAATTTGGAAAGGG - Intronic
1080114844 11:28610418-28610440 TAGCCTCTGCAACTTGGACAGGG - Intergenic
1080252204 11:30246160-30246182 TAGCCTCTGGAAGTTGGAAAAGG + Intergenic
1080376844 11:31723113-31723135 TGGCATCTTGAGATGGGACATGG - Intronic
1081486164 11:43531079-43531101 AAGCACCTTGTATTTGGACTAGG - Intergenic
1082960062 11:58910887-58910909 TTGCTTCTTGAATTTGGTCTTGG - Intronic
1082975635 11:59068644-59068666 TTGCTTCTTGATTTTGGTCATGG - Intergenic
1087542634 11:99540674-99540696 GAGCATCTTAAGTTTGGAAAGGG + Intronic
1087942314 11:104113281-104113303 TAGGAGCTTCGATTTGGACATGG - Intronic
1089756508 11:120691518-120691540 TAACACCTAGGATTTGGACATGG + Intronic
1090557805 11:127895857-127895879 TAAAATCTTGAATATGAACAGGG + Intergenic
1093820577 12:23613032-23613054 TAGCAACTTGAGTTTAAACATGG + Intronic
1095286333 12:40415324-40415346 GAGTCTCTTGAATTTGGACTTGG + Intronic
1095954881 12:47800232-47800254 TAGCAGGGTGACTTTGGACAGGG - Intronic
1098822439 12:75249993-75250015 CAGCATCTAGAATCTGGAAAAGG - Intergenic
1099746366 12:86709081-86709103 TCTCATCTTGAATTTTGAGAGGG + Intronic
1102226339 12:111230837-111230859 TTGCAGCTTGAAATTGGCCACGG - Intronic
1102567728 12:113807980-113808002 TAGCCTTGTGAATTTGGGCAAGG + Intergenic
1103391393 12:120576213-120576235 TAGAATCTTGAGTTGGTACAGGG + Intronic
1107512756 13:41101449-41101471 TGGCATTTGGAATTTTGACAAGG - Intergenic
1107981928 13:45742297-45742319 TAGGAGCCTGAATTTTGACAAGG + Intergenic
1109369894 13:61409820-61409842 TAGCATTTTATATTTGAACATGG - Intronic
1110486091 13:76044860-76044882 TAGCATATAGAATTTTGGCATGG - Intergenic
1111351723 13:87039664-87039686 TTGCATATTGAATTTTGTCATGG + Intergenic
1112810611 13:103214279-103214301 TAGCCTGCTGAATTTGGAGATGG + Intergenic
1115112938 14:29846334-29846356 GAGTATTTTGAATTTGGTCAAGG + Intronic
1115173833 14:30539099-30539121 TATCACCTTGAATTTGGCAATGG + Intergenic
1116395763 14:44447205-44447227 TAGCATGTGGAATTTGCACTGGG - Intergenic
1116712529 14:48386416-48386438 AAGCCTCTAGAATTTGGAAAAGG - Intergenic
1119960576 14:78851301-78851323 TGGCATCTTGAATTTCACCAGGG - Intronic
1121543176 14:94743655-94743677 TAGAATCTGGAATTAGGTCATGG + Intergenic
1122776933 14:104121506-104121528 TATCATCTTGACTGTGGTCATGG - Intergenic
1125006251 15:34821170-34821192 TAGTAGCTTGAAATTGGCCATGG - Intergenic
1125402438 15:39318747-39318769 CAGCTCCTTGCATTTGGACATGG - Intergenic
1126122148 15:45263086-45263108 TTGCATCTTGAATTTCCAGAGGG + Exonic
1127636606 15:60876820-60876842 TAGCATCTTGAATTGTGACTAGG - Intronic
1129098763 15:73238113-73238135 TGGCAGCTTGAAATTGGGCATGG + Intronic
1130338762 15:82980771-82980793 TAGAGTCTTGAATTTGGCCCTGG + Intronic
1130859310 15:87872548-87872570 TAGCATGTTGGTTTTGAACAGGG + Intronic
1131121436 15:89825405-89825427 CAGCAGCTTGAAATTGGACAGGG - Intergenic
1132183279 15:99779029-99779051 TGGCCTCTTGAAGTTGGAAAAGG - Intergenic
1133487041 16:6230150-6230172 TAGCATCTTGTTTTTGCAAAGGG - Intronic
1136420851 16:30131967-30131989 TAGCCTCTTCAATTTGGAGTTGG + Intergenic
1140713370 16:77698798-77698820 GAGAATCTTGAATTGGGTCATGG + Intergenic
1141067802 16:80927946-80927968 TAGCATGGAGATTTTGGACAGGG - Intergenic
1144394323 17:14828841-14828863 TGGCAGCTTGAAATTGGCCATGG - Intergenic
1146129277 17:30256921-30256943 TACCTCCTTGAATTTGTACAGGG + Intronic
1148021325 17:44556096-44556118 TAGGATTTTAAATTTGGAAAGGG - Intergenic
1148429394 17:47629914-47629936 TAGCTTCGTGACTTAGGACACGG - Intergenic
1149858055 17:60102338-60102360 TATCATCTTTAATTTTGAGAAGG - Intergenic
1151018574 17:70585538-70585560 TAGAAACTTGAACTTGGAAATGG - Intergenic
1152367542 17:79865314-79865336 TGGCAGCTTGAAATTGGCCATGG - Intergenic
1155614987 18:27711914-27711936 TAACATCTTGGCTGTGGACAAGG - Intergenic
1158074115 18:53508826-53508848 TGGCCTCTTTCATTTGGACAGGG + Intronic
1159110878 18:64055121-64055143 TTGCATCTTTAATTTGTACTGGG + Intergenic
1159162917 18:64667701-64667723 GAGCATCTTGCTTTTGGACAGGG - Intergenic
1159322929 18:66877001-66877023 CAGCATCTAGAAGTTGGAAAAGG + Intergenic
1159378794 18:67629689-67629711 TAGCACTGTGATTTTGGACAAGG - Intergenic
1163106750 19:15127678-15127700 GAGCCTCTTGAAGTTGGAGAAGG - Intergenic
925095085 2:1191984-1192006 TAGGATCTTCAAATTGGAAAGGG + Intronic
925958039 2:8987557-8987579 TGGAATCTGGAATTTGGGCAAGG + Intronic
926634482 2:15165391-15165413 TAGCACCTAGAATTTGGGAATGG - Intergenic
926997318 2:18750447-18750469 TAACATCTGGAATTTGGGGAGGG + Intergenic
927854748 2:26521019-26521041 TAGAAGCTTGAAGTTGGCCATGG - Intronic
929431382 2:41890154-41890176 TAGAATCTTGATTTTTCACAGGG + Intergenic
932192896 2:69756044-69756066 TAGTAACTTGAAATTGGTCAGGG + Intronic
933175988 2:79173640-79173662 TTGGATCTTGACTATGGACATGG - Intergenic
933296315 2:80495227-80495249 TAGGAACTTGAATTTGTAAAAGG - Intronic
933537436 2:83593914-83593936 TATAATCTTGGATTTGGCCAGGG + Intergenic
936328199 2:111523662-111523684 CCGCATCATGAATGTGGACATGG + Intergenic
939043750 2:137224376-137224398 GTGGAGCTTGAATTTGGACATGG - Intronic
941210342 2:162629709-162629731 TAGTAGCTTGAAATTGGCCATGG + Intronic
1169016313 20:2295598-2295620 TAGCATCTTCCACTTGCACAGGG - Intergenic
1169843162 20:9961762-9961784 AATCATCATGAATCTGGACAGGG + Intergenic
1177665723 21:24156290-24156312 TAGCTTCTTTAATTTGCATAAGG - Intergenic
1177974524 21:27830403-27830425 TCTCATCTTGAATGTGGTCAGGG - Intergenic
1178661943 21:34514245-34514267 TAGCTGCTGGAATTTGAACAGGG + Intronic
1178735376 21:35144464-35144486 TAGCAGTGTGACTTTGGACAAGG + Intronic
949184788 3:1177491-1177513 TAGAATCTTGAATCTTGACAAGG - Intronic
951786739 3:26428832-26428854 TAGCCTCTAGAAGTTGGAAAAGG + Intergenic
952106491 3:30075992-30076014 CAGCCTCTTGAATCTGGAAAAGG + Intergenic
952510401 3:34047828-34047850 TGGCACCTTGATTTTGGACTTGG + Intergenic
953526401 3:43693274-43693296 TGGCAGCTTGAAATTGGCCATGG + Intronic
954153071 3:48668463-48668485 TGGAAACTTGAATTTTGACAAGG + Intergenic
955221283 3:57025509-57025531 TAGCATGTTGAAGTTGGCCATGG + Intronic
955655401 3:61240068-61240090 TAGCCTCTTGAACTTCCACAAGG - Intronic
955844811 3:63151199-63151221 TAGCATATTGAAGTTAGAAATGG + Intergenic
956217692 3:66866327-66866349 TGGCATCTGGAATTTTGATAGGG + Intergenic
956616011 3:71173548-71173570 TAGCATCTTAACTTTGGCCTAGG - Intronic
957111046 3:75958215-75958237 TAAGATCTTGAGTTTGGCCAAGG - Intronic
957591283 3:82201914-82201936 TAGGACCAGGAATTTGGACAGGG - Intergenic
960099014 3:113718278-113718300 TACCATCTTGAAGCTTGACAAGG - Exonic
960272908 3:115693868-115693890 TAGGATCAATAATTTGGACATGG + Intronic
961914152 3:130352885-130352907 TAGCTTTGTGAATTTGGGCAGGG + Intronic
962063707 3:131957296-131957318 TAGCTTCTTGAATTGAGCCAAGG + Intronic
963444212 3:145382883-145382905 TGGTATCTTGAAATTGGCCATGG + Intergenic
963657182 3:148069513-148069535 TGGCAGCTTGAAATTGGCCATGG + Intergenic
964052014 3:152405996-152406018 TAGCATCATGAAACTGGAAATGG - Intronic
966610080 3:181859516-181859538 TAGCACCTTGAATGTGGAGGAGG + Intergenic
966658784 3:182390670-182390692 TAGCATCTTGGAGATTGACAAGG - Intergenic
967812670 3:193773743-193773765 TGGCATGTGGATTTTGGACATGG + Intergenic
969312758 4:6363617-6363639 TGGCAGCTTGAATTTGGCCATGG - Intronic
970331860 4:14994870-14994892 AAGCACCTTGAAGTTGGTCAAGG + Intergenic
973775728 4:54239590-54239612 TAGCAAGTTGAATCTGGGCAAGG - Intronic
973794038 4:54405801-54405823 TAGCATCTTGGAGATGGAGATGG - Intergenic
975141982 4:70927722-70927744 TAGCATCTTGGTTTTTAACATGG + Intronic
975527842 4:75370792-75370814 CAGCATGTTTACTTTGGACATGG - Intergenic
976009212 4:80467186-80467208 TAGCAGCTTGAAATTGGTCAAGG + Intronic
978683037 4:111405904-111405926 AAGCATCTGGATTTTGGAGAGGG - Intergenic
979305805 4:119142177-119142199 TGGTAGCTTGAATTTGGCCATGG - Intronic
980268471 4:130551891-130551913 TAGCATCTATAATCTGGAAAAGG - Intergenic
982610694 4:157570633-157570655 TACCATCTTTCATTTGGATAAGG - Intergenic
984161592 4:176259240-176259262 TAGAATCATGAATTTGGAAAAGG - Intronic
985878090 5:2615919-2615941 TAGCACCAGGAATTTGGACAGGG + Intergenic
988008940 5:25458150-25458172 CAGCATCTTGATTTTGGTGATGG + Intergenic
988016112 5:25562640-25562662 TCTCATCTTGAATTTGAAGATGG - Intergenic
988986553 5:36624946-36624968 TAGCATCTTGAACTCCTACATGG - Intronic
989135247 5:38147765-38147787 TTTCATGTTGAATTTGCACATGG - Intergenic
989327486 5:40216316-40216338 TAGCATCTAGAAGTTGGAAAAGG - Intergenic
990054064 5:51547894-51547916 TAGAATCTTCAATGGGGACATGG - Intergenic
991131257 5:63124777-63124799 TAGTATCTTGAAATTGGTTAAGG + Intergenic
991449639 5:66738362-66738384 TAGCTCCTTGCAGTTGGACAGGG - Intronic
991960756 5:72041709-72041731 TAGCATCCTGAACTAAGACAAGG - Intergenic
992303727 5:75412194-75412216 TAGAAAATGGAATTTGGACAAGG - Intronic
992409100 5:76487874-76487896 TACCATTTTGAATTTTGAAAAGG - Intronic
993633538 5:90317103-90317125 TAGCACCTTGATTGTGGACTTGG - Intergenic
994188500 5:96841466-96841488 CAGCAGCTTGAAATTGGTCATGG - Intronic
994209776 5:97074377-97074399 GAGTATCTTGAATTTAGACAAGG + Intergenic
997267883 5:132507327-132507349 AAACATCTTCAATTTGGAAAAGG + Intergenic
997662040 5:135596683-135596705 TCCATTCTTGAATTTGGACAAGG + Intergenic
997707382 5:135969636-135969658 AAGCAACTTGAATTTTGATAGGG + Intergenic
999998013 5:157110806-157110828 TAGCAGCATGAACTTGGTCAAGG + Intronic
1000163016 5:158618769-158618791 CAGCAACTTGTATTTGGAAACGG - Intergenic
1000355049 5:160386306-160386328 CAGCCTCTAGAATTTGGAAAAGG - Intergenic
1002359696 5:178660923-178660945 TAGCATCTGGAGTCTGGGCACGG - Intergenic
1003437507 6:6105622-6105644 TAGAATTTAGAATATGGACAGGG - Intergenic
1003952718 6:11131380-11131402 TGGCATCAAGAATTTTGACAGGG - Intronic
1004345626 6:14846589-14846611 CAGCACCTTGATTTTGGACTTGG + Intergenic
1005313954 6:24586591-24586613 TAGCATCTTGAACTAAAACAAGG - Intronic
1006094953 6:31650244-31650266 TATCATCTTGTGTTTGGAAAGGG - Intronic
1007381537 6:41493200-41493222 TAGTAGCTTGAAGTTGGCCATGG + Intergenic
1008164413 6:48118523-48118545 TAGCTGCTTGAGTTTGTACAAGG - Intergenic
1008338262 6:50332845-50332867 TAGTTTCTTGAATTTTGACCTGG + Intergenic
1011512977 6:88121708-88121730 GAGCATGCTGCATTTGGACATGG + Intergenic
1015004569 6:128263438-128263460 TAGTAGCTTGAAATTGGCCATGG - Intronic
1015521031 6:134131388-134131410 TAGTTACTTGAATTTGGAAAAGG + Intergenic
1015685930 6:135859983-135860005 TAGCATCTGGAACTTGAACTCGG - Intronic
1015905461 6:138112339-138112361 TAGCATGTTGAATTTCCTCAAGG - Intergenic
1017519842 6:155192153-155192175 CAGCCTCTAGAATTTGGAAAAGG + Intronic
1019685984 7:2382438-2382460 TGGCATCATGAAGTTGGACTTGG + Intergenic
1023095274 7:36654040-36654062 TAGAATCATGGTTTTGGACATGG + Intronic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1036759996 8:11502027-11502049 TAGCAACTTGAAATTGGCCCTGG - Intronic
1037127005 8:15363626-15363648 TGGCATCTTGAGTTTGGTAATGG + Intergenic
1038149053 8:24926093-24926115 GAGCTGCTTGGATTTGGACATGG - Intergenic
1038932916 8:32215187-32215209 TAACATCTTGTATTTGTATAAGG + Intronic
1039753022 8:40495532-40495554 TAACACCTTGAATGTGGACAAGG - Intergenic
1041781514 8:61582192-61582214 GAGCATCTTGAATTTATACCAGG - Intronic
1041861744 8:62521659-62521681 GAGCATCTTGGATCTGGACCTGG + Intronic
1044199413 8:89415440-89415462 TGGCAACTTGCATTTGAACAGGG - Intergenic
1045422646 8:102031519-102031541 TAGCATCATGAATTAGCATAAGG - Intronic
1045533934 8:103009557-103009579 TGGCTTCTTGAATTTGTTCAAGG - Intergenic
1046389719 8:113554370-113554392 TGGCACTTTGATTTTGGACATGG + Intergenic
1046391228 8:113575500-113575522 TTGAATCCTGATTTTGGACAGGG + Intergenic
1047068837 8:121319061-121319083 TAGTAGCTTGAAATTGGCCATGG - Intergenic
1047222398 8:122928873-122928895 GATCATCTTGACTTGGGACAAGG + Intronic
1047314980 8:123724576-123724598 TAGCATCTTGGATAAGGTCAAGG - Intronic
1048030804 8:130630069-130630091 ATGCATCTACAATTTGGACAGGG + Intergenic
1048928333 8:139290819-139290841 TAGGAGCTTGAATTTGTCCATGG + Intergenic
1051481249 9:17563831-17563853 TAGCACCTTGATCTTGGACCTGG + Intergenic
1052481133 9:29027945-29027967 TCTCATCTTGAAAGTGGACAAGG - Intergenic
1053182132 9:35981758-35981780 TGGGATCCTGAATTTGGAAATGG - Intergenic
1054838777 9:69712003-69712025 TATCATCTTGCATTTGGAGCAGG - Intronic
1055618721 9:78100481-78100503 TATCATCCTCAATTTGGAGATGG - Intergenic
1056197522 9:84242460-84242482 TTGCTTCTTGAAATTGTACACGG + Intergenic
1058177918 9:101759687-101759709 TACTACCTTGAATTTGTACATGG - Intergenic
1058646757 9:107138275-107138297 TGGCAACTTGAAATTGGCCATGG + Intergenic
1061442731 9:130617592-130617614 TTACATCTCGCATTTGGACATGG + Intronic
1186890968 X:13958807-13958829 CAGCCTCTGGAATTAGGACATGG + Intergenic
1187066593 X:15845480-15845502 TATCATCTTTAATTTTGAGAAGG - Exonic
1187067211 X:15853581-15853603 CACCATCTTGAATTTGAACACGG + Intronic
1187694815 X:21908713-21908735 TCACATCTTGAACTTGGACTAGG + Intergenic
1187793793 X:22979527-22979549 GAGGATGTTGCATTTGGACAGGG - Intergenic
1189402598 X:40685695-40685717 AAGGCTCTTGAATTTGCACAAGG + Intronic
1190468854 X:50755221-50755243 TAGCAACTTGAAACTGGCCATGG + Intronic
1191608057 X:63082967-63082989 TAGCAGCCTGAATTAGGAAATGG - Intergenic
1192677010 X:73208330-73208352 TAGCAGAGTGAGTTTGGACAGGG - Intergenic
1194589869 X:95786830-95786852 TGGTATCTTGAATGTGGTCATGG - Intergenic
1196889023 X:120274724-120274746 ACGCATCTTGAAAGTGGACAAGG + Intronic
1197650282 X:129056708-129056730 TAGTAGCTTGAAATTGGCCACGG - Intergenic
1198409415 X:136350587-136350609 GAGAATTTTGTATTTGGACAAGG - Intronic
1199152346 X:144502209-144502231 TAGCATATTGAATTTTAAAATGG + Intergenic
1199191579 X:144977774-144977796 TAGCAGCTTGAAATTGGCCATGG - Intergenic
1199210052 X:145197501-145197523 TAACATTTTGAATTTGGAAAAGG - Intergenic
1199459859 X:148072461-148072483 CAGCACCTTGATTTTGGACTTGG + Intergenic
1199482852 X:148316795-148316817 TTGTTTCTTGAATTTGGAGATGG + Intergenic
1199688544 X:150287396-150287418 TAACATAATGAATTTGGGCAGGG - Intergenic