ID: 915812011

View in Genome Browser
Species Human (GRCh38)
Location 1:158923131-158923153
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915812007_915812011 0 Left 915812007 1:158923108-158923130 CCACAGTTGTGAAAATGTGTTCT No data
Right 915812011 1:158923131-158923153 GGGTAGGTGACTGCAAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr