ID: 915815774

View in Genome Browser
Species Human (GRCh38)
Location 1:158963162-158963184
Sequence CTGCAGCAGCAGTGGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1088
Summary {0: 3, 1: 15, 2: 101, 3: 229, 4: 740}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915815774_915815781 7 Left 915815774 1:158963162-158963184 CCCCTCTGCCACTGCTGCTGCAG 0: 3
1: 15
2: 101
3: 229
4: 740
Right 915815781 1:158963192-158963214 GCCCTGCTGCCTTCAGACTGGGG 0: 1
1: 1
2: 4
3: 58
4: 447
915815774_915815779 5 Left 915815774 1:158963162-158963184 CCCCTCTGCCACTGCTGCTGCAG 0: 3
1: 15
2: 101
3: 229
4: 740
Right 915815779 1:158963190-158963212 CTGCCCTGCTGCCTTCAGACTGG 0: 1
1: 0
2: 5
3: 48
4: 381
915815774_915815780 6 Left 915815774 1:158963162-158963184 CCCCTCTGCCACTGCTGCTGCAG 0: 3
1: 15
2: 101
3: 229
4: 740
Right 915815780 1:158963191-158963213 TGCCCTGCTGCCTTCAGACTGGG 0: 1
1: 0
2: 2
3: 49
4: 423
915815774_915815786 30 Left 915815774 1:158963162-158963184 CCCCTCTGCCACTGCTGCTGCAG 0: 3
1: 15
2: 101
3: 229
4: 740
Right 915815786 1:158963215-158963237 AAGGAACTGCAGTTGCCCTAAGG 0: 1
1: 0
2: 0
3: 13
4: 163
915815774_915815784 11 Left 915815774 1:158963162-158963184 CCCCTCTGCCACTGCTGCTGCAG 0: 3
1: 15
2: 101
3: 229
4: 740
Right 915815784 1:158963196-158963218 TGCTGCCTTCAGACTGGGGAAGG 0: 1
1: 8
2: 33
3: 99
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915815774 Original CRISPR CTGCAGCAGCAGTGGCAGAG GGG (reversed) Intronic
900008237 1:79684-79706 CTGTAGAGGCAGTGGCAGAGGGG - Intergenic
900169781 1:1261239-1261261 CGGGAGCAGCAGTGCCATAGAGG + Intronic
900341125 1:2189860-2189882 CTCCAGCGGCAGGAGCAGAGAGG - Intronic
900351300 1:2236075-2236097 CTGCAGCTGCAGAGGCACCGAGG - Intronic
900895296 1:5479106-5479128 CAGCAGCAGCACAGGCAGGGAGG - Intergenic
901689192 1:10961385-10961407 CTGAAGGAGCAGGGGCTGAGCGG - Intronic
901745878 1:11373176-11373198 CTGCAGCAGCCCTGCCAGGGAGG - Intergenic
902228273 1:15010744-15010766 ATTCAGCAGAAGTAGCAGAGTGG + Intronic
903249950 1:22045630-22045652 CAGCATGAGCAGTGGCAGAGAGG + Intergenic
903373031 1:22849126-22849148 GTGCAGCAGCAGTGGGAGTGGGG - Intronic
904048152 1:27621798-27621820 CTGCAGTGGCTGGGGCAGAGCGG - Intronic
904334462 1:29787759-29787781 CTGCTGCATCAGTGGTAGAGAGG + Intergenic
904563622 1:31414191-31414213 CTGTAGCTGCAGCCGCAGAGGGG + Intronic
906265345 1:44424692-44424714 GAGGAGGAGCAGTGGCAGAGGGG - Intronic
906569300 1:46822597-46822619 CTGCAGCAGCTGTGGGGGATGGG + Intergenic
906680121 1:47720502-47720524 CTGCAGGAGGAGTGGCCCAGTGG - Intergenic
906864737 1:49405543-49405565 GAGCAGCAGCAGTGGCAGCATGG - Intronic
906960831 1:50418739-50418761 CCGCAGCAGCGGCGGCCGAGCGG + Exonic
906992723 1:50755858-50755880 CTGCTGCAGCTGTGGCTGAAAGG - Intronic
907534500 1:55137544-55137566 CTCCAGCAGCAGCAGCAGTGGGG - Exonic
907809187 1:57851597-57851619 TTGCAGGAGCAAAGGCAGAGGGG - Intronic
908667708 1:66510715-66510737 CAGCAGCCTCAGTGGCAGTGGGG - Intergenic
908932548 1:69334412-69334434 CAGGATCAGCAGTGGCAGTGTGG + Intergenic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
909691298 1:78410284-78410306 CTGCATCAGCAGTGGAAAAGTGG + Intronic
909695608 1:78465273-78465295 CTGCAGTGGCAATGGCTGAGGGG + Intronic
909806150 1:79875925-79875947 CTGCAGCTGCAGTAGTGGAGAGG - Intergenic
909875279 1:80794684-80794706 CTCCAGCATGAGTGACAGAGAGG + Intergenic
910065244 1:83143687-83143709 CTGCAGCTGCAATGACAGAGGGG + Intergenic
910171862 1:84386495-84386517 CAGCAGCAGAGGTAGCAGAGGGG + Intronic
910514014 1:88037573-88037595 TGGCAGCAGCAGTGGCAGAAGGG - Intergenic
910674101 1:89800008-89800030 TTGCAGCAGCAGCAGCAAAGGGG + Intronic
910812649 1:91253809-91253831 CTGCAGAGGCAATGGCAGAGAGG - Intergenic
911002406 1:93180177-93180199 CAGCAGCACCGGAGGCAGAGCGG + Exonic
911569620 1:99507599-99507621 CTTCAGCAACAGAGGGAGAGGGG - Intergenic
911853058 1:102842688-102842710 CTGTGGCAGCAGTGGCTAAGGGG + Intergenic
912100089 1:106193186-106193208 CTGTACAGGCAGTGGCAGAGAGG - Intergenic
912595931 1:110875669-110875691 CTGCACCTGCAGTGGCAGATGGG - Intronic
912609120 1:111025261-111025283 CTGCAGGAGGAGTGGGGGAGGGG - Intergenic
912614616 1:111085615-111085637 CAGCAGCAGCTGTGACAGAGGGG + Intergenic
913410193 1:118542597-118542619 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
913592312 1:120341367-120341389 TTCCAGCAGCGGCGGCAGAGCGG - Intergenic
913609614 1:120497271-120497293 CTGCAACAGCAGCTGGAGAGCGG - Intergenic
913651046 1:120913778-120913800 TTCCAGCAGCGGCGGCAGAGCGG + Intergenic
914434403 1:147647550-147647572 CTGCAGGAGCAGGTGCCGAGAGG - Exonic
914525186 1:148459252-148459274 TTCCAGCAGCGGCGGCAGAGCGG - Intergenic
914581576 1:149024573-149024595 CTGCAACAGCAGCTGGAGAGCGG + Exonic
914598492 1:149176578-149176600 TTCCAGCAGCGGCGGCAGAGCGG + Intergenic
914641218 1:149607882-149607904 TTCCAGCAGCGGCGGCAGAGCGG + Intergenic
914826687 1:151142574-151142596 CAGCAGCAGCAGTAGCAGCAAGG + Exonic
915137170 1:153740751-153740773 CAGCAGCAGCAGTGGCTGCAGGG - Intronic
915312823 1:155012854-155012876 CAGCTGCTGGAGTGGCAGAGGGG + Intronic
915815774 1:158963162-158963184 CTGCAGCAGCAGTGGCAGAGGGG - Intronic
916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG + Intronic
916268655 1:162917839-162917861 CTGCAGTGGCAGTGGCAGAGGGG + Intergenic
916456104 1:164972443-164972465 AGGCAGCAGCAGAGGCAGAAGGG - Intergenic
916568909 1:166008217-166008239 CTGCAGGGGCAGTGGCAGAGAGG + Intergenic
916633196 1:166638657-166638679 CTGCAGCTGCTGTGGCAGAGGGG - Intergenic
917055617 1:170978338-170978360 CTGCTGTGGCAGTAGCAGAGGGG + Intronic
917149393 1:171928675-171928697 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
917173292 1:172201701-172201723 CTGCAAAGGCAATGGCAGAGAGG + Intronic
917506305 1:175630076-175630098 CTTCAGCAGCCGTGGCAGGCAGG - Intronic
917585756 1:176425304-176425326 CTACTGTAGCAGTGGCAGAGGGG + Intergenic
917588459 1:176452464-176452486 GTGTAGCAGGAGAGGCAGAGAGG + Intergenic
917604901 1:176617282-176617304 CTGAGGCAGCAGTGACATAGGGG + Intronic
918181291 1:182087607-182087629 CTGCAGCTGGGGTGGCTGAGAGG - Intergenic
919263884 1:195237282-195237304 CTGCAGTAGGAGAGGCACAGCGG + Intergenic
919453678 1:197799630-197799652 CTGCAGCTGCAATGGCAGATGGG + Intergenic
919577981 1:199336380-199336402 CTGCAGAGGCAATGGCAAAGGGG + Intergenic
919673983 1:200363194-200363216 CCACAGCATTAGTGGCAGAGGGG - Intergenic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
920697671 1:208193863-208193885 CTGCAGCTGGGGTGACAGAGTGG + Intronic
920727036 1:208445860-208445882 CTGCAGCTGCTGTGGCAGATAGG + Intergenic
921012959 1:211161267-211161289 CTACAGAGGCAGTGGCAGAGAGG + Intergenic
921318458 1:213914562-213914584 ACTCAGAAGCAGTGGCAGAGGGG + Intergenic
921332350 1:214051956-214051978 CAGCAGCTGGAGTGGCTGAGCGG - Intergenic
921404493 1:214764591-214764613 TGGCACCAGCAGTGGCAGTGTGG + Intergenic
921903132 1:220468814-220468836 CAGCAGCAGCATTTGCAGAAAGG + Intergenic
922698269 1:227742902-227742924 TTGCAGCTGCTGTGGCAGAACGG + Intronic
922902409 1:229147217-229147239 CGTCAGCATCTGTGGCAGAGGGG + Intergenic
923912849 1:238468604-238468626 CTGAGCCAGGAGTGGCAGAGTGG - Intergenic
924243680 1:242061978-242062000 GTACAGCTGGAGTGGCAGAGGGG + Intergenic
924331784 1:242946808-242946830 CAGAAGCAGCAGTGGCAGTATGG - Intergenic
924690342 1:246343467-246343489 CTGCAGAAGCAGGGTCAAAGAGG + Intronic
924885370 1:248210008-248210030 CTGCTGCTGCTGTGGCAGATGGG + Intergenic
1062895610 10:1101077-1101099 CTGCTGCAGGAGTGGCTGACAGG - Intronic
1062970653 10:1645762-1645784 CTCCAGGAGGAGAGGCAGAGGGG - Intronic
1062988424 10:1791426-1791448 CTTCAGGATAAGTGGCAGAGTGG + Intergenic
1063381137 10:5587092-5587114 CAGCAGCAGCAATGACTGAGAGG + Intergenic
1063451783 10:6154875-6154897 GTGCAGCTGCTGTGGCAGTGCGG - Intronic
1063614700 10:7591627-7591649 CTGCAGCAGCAAAGACTGAGAGG - Intronic
1063958748 10:11288586-11288608 ATGCAGCAGGAGTGGCAGGTAGG + Intronic
1064701179 10:18023468-18023490 CTGCTACAGCAGTGGCAGAGGGG + Intronic
1064963769 10:20994902-20994924 CTGTCTCAGGAGTGGCAGAGAGG + Intronic
1065730478 10:28705550-28705572 CTGCAGCAGCCCTGGCTGTGTGG + Intergenic
1065853128 10:29807458-29807480 CTCCAGCCACAGTTGCAGAGAGG + Intergenic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1066156457 10:32683709-32683731 CTGCAGCAGCAATGGCAGAGGGG + Intronic
1066406955 10:35127291-35127313 GTGGAGCAGCAGAGGCCGAGCGG + Intronic
1067071008 10:43132054-43132076 CAGCAGGAGCCCTGGCAGAGAGG - Intergenic
1067578834 10:47426288-47426310 CTGCAACTGTAGTGGCAGAGAGG - Intergenic
1067819963 10:49519888-49519910 CTGAGGCAGCAGGTGCAGAGTGG - Intronic
1068097612 10:52511645-52511667 CAGCAGCAGCAGGACCAGAGAGG + Intergenic
1068218298 10:54010922-54010944 CTGCTGTGGCAGTGGCAGAGTGG - Intronic
1068218347 10:54011190-54011212 CTGCAGCAGCAGTGGTAGAGGGG - Intronic
1068596278 10:58905792-58905814 TTGCTGTGGCAGTGGCAGAGGGG - Intergenic
1069212612 10:65780141-65780163 GTGCTCCAGCTGTGGCAGAGGGG - Intergenic
1069619261 10:69826406-69826428 CTGCAGCAGTGGTGGCATGGGGG + Intronic
1070115588 10:73525810-73525832 CTGCAGCAGCAGTAGTAAAAAGG - Intronic
1070512755 10:77176347-77176369 GTGCAGCTGCAGTGACTGAGGGG - Intronic
1070870589 10:79748281-79748303 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
1071023191 10:81082846-81082868 CTGCAGTGGCAGTGGCAGAGGGG + Intergenic
1071052823 10:81472885-81472907 CTGCAGCAGCAGCGCCAGATGGG - Intergenic
1071429658 10:85596705-85596727 GTGCAGCAGCTGAGGCACAGTGG + Intergenic
1071511405 10:86264694-86264716 CTGCAGCTGCCTGGGCAGAGCGG - Intronic
1071637507 10:87270493-87270515 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
1071657738 10:87467458-87467480 CTGCAGAGACAGTGGCAGAGAGG + Intergenic
1071882106 10:89910894-89910916 CAGCAGCAGCAGTGGCAGCATGG + Intergenic
1073783777 10:106866169-106866191 CTGCAGAGTCAGTGGCATAGAGG - Intronic
1074412461 10:113240137-113240159 CTGCAGGAGGAGTGGGAGGGAGG - Intergenic
1074746799 10:116542578-116542600 CTGCAACACCAGAGGCAGATTGG - Intergenic
1074985817 10:118658697-118658719 CTGCAGCTGCTGTGGGAGATGGG + Intergenic
1075830654 10:125408112-125408134 CTGCAGCAGCAGTGGCCGCATGG - Intergenic
1076163394 10:128263278-128263300 CACCAGCTGCAGTGGCAGTGGGG - Intergenic
1076331794 10:129675704-129675726 CAGCAGCAGCAGTGGGTGTGTGG - Intronic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076375829 10:129984028-129984050 CTGCAGCTGCTGTGGAAGACGGG - Intergenic
1076698151 10:132256950-132256972 CAGCAGCAGCACTGGATGAGGGG + Intronic
1076782248 10:132730798-132730820 CAGCCGCTGCAGGGGCAGAGGGG - Intronic
1077133159 11:984877-984899 ATACAGCAGCACTGGCAGAAAGG - Intronic
1077256257 11:1584784-1584806 CTGCTCCAGCTGTGGCAAAGGGG - Exonic
1077256329 11:1585048-1585070 CTGCTCCAGCTGTGGCAAAGGGG - Exonic
1077262461 11:1630080-1630102 CTGCTCCAGCTGTGGCAAAGGGG + Exonic
1077370016 11:2177448-2177470 GGGCAGCAGCAGTAGCAGAAGGG - Intergenic
1077411969 11:2407872-2407894 CTCCAGCAGCAGTGGGTGGGTGG + Exonic
1077746562 11:4913761-4913783 CTGAAGCAGAAGTGAGAGAGAGG - Intronic
1077988683 11:7381832-7381854 CTAGAGCTGCAGTGGCAGATGGG - Intronic
1078294825 11:10057316-10057338 TTGCAGAGGTAGTGGCAGAGAGG - Intronic
1078478946 11:11659449-11659471 CTAGTGCAGCAGTGGCAGTGAGG - Intergenic
1078482193 11:11687408-11687430 CTGCACCAGCCGTGGCTGAAGGG + Intergenic
1078909151 11:15714649-15714671 CTGAACCAAAAGTGGCAGAGAGG + Intergenic
1078993278 11:16670460-16670482 CTGCAGAGGCAGTGGCAGAGAGG - Intronic
1079181380 11:18196747-18196769 CAGCAGCAGCAGTACCAGATAGG - Intronic
1079650822 11:22926675-22926697 CTGCAGCCTGAGTGACAGAGAGG + Intergenic
1079837265 11:25350441-25350463 CTGCAGTGACAGTGGCAGAGGGG + Intergenic
1079837318 11:25350721-25350743 CGGCAGCTGCAATGGCAGAGGGG + Intergenic
1079838679 11:25366993-25367015 CTGCTCCAGCAGTGGCTGAAAGG - Intergenic
1079869553 11:25780772-25780794 CTGCAGTTGCAAAGGCAGAGGGG - Intergenic
1079882697 11:25945606-25945628 CTGCAGTGGCAGTGGCTGAGGGG - Intergenic
1079989732 11:27233940-27233962 CTGCTGTAACAGTGGAAGAGGGG + Intergenic
1080105231 11:28504681-28504703 CTACAGCAGCAGAGCCAGCGTGG + Intergenic
1080408841 11:32004410-32004432 CATCAGCAGGAGTGCCAGAGGGG + Intronic
1080908070 11:36566760-36566782 CTGCAGTAACACTGGGAGAGAGG - Intronic
1081083313 11:38769332-38769354 GAGCGGCAGCAGTGGCAGTGTGG - Intergenic
1081212541 11:40354601-40354623 CTGGAGCAGCAGTGGCCATGAGG - Intronic
1081343623 11:41956508-41956530 CTGCAGCTGCAATGGTGGAGGGG - Intergenic
1081488717 11:43550416-43550438 CTGCATGAGCAAAGGCAGAGAGG + Intergenic
1081634581 11:44712296-44712318 CTGCAGCAGCAGTGGCAGGTTGG + Intergenic
1081797207 11:45828947-45828969 CTGCAGCAGCAGGGAAGGAGTGG - Intergenic
1081814380 11:45930331-45930353 AAGCAGCAGCAGGGACAGAGAGG + Intronic
1082615722 11:55356967-55356989 CTGCTGTGGCAGTGGAAGAGTGG - Intergenic
1082615760 11:55357246-55357268 CTGCAGTGGCAGTGGGAGAGAGG - Intergenic
1083186293 11:61019751-61019773 CTGCAGCAGCACTGGCATGGGGG - Exonic
1083829137 11:65219923-65219945 TGGCAGCAGCAGAGGCAGTGAGG + Intergenic
1083952722 11:65965786-65965808 CTGCAGCAGGGGTGGTACAGGGG + Intronic
1084175007 11:67418479-67418501 CTCCAGCAGCACAGGCAGAAAGG - Exonic
1084758092 11:71251805-71251827 CAGCAGCAGCTGTCGCGGAGAGG - Intronic
1084793556 11:71489953-71489975 CTGCACCAGCGTTGGCAGCGGGG + Intronic
1085022244 11:73217224-73217246 CACCAGGAGCAGTAGCAGAGTGG - Intergenic
1085768627 11:79305999-79306021 CTGCGCCAGCAGAGTCAGAGAGG - Intronic
1085782678 11:79423662-79423684 CTGGAGCAGCAGGCGCAGGGAGG + Intronic
1085814876 11:79727313-79727335 GAGAAGCAGCAGTGGCAGCGCGG + Intergenic
1086303931 11:85459727-85459749 CTGCAGCTGCAATTCCAGAGGGG + Intronic
1086569130 11:88262912-88262934 CTGTAGAGACAGTGGCAGAGAGG + Intergenic
1087066083 11:94029301-94029323 CTCCTGCAGCAGAGGAAGAGAGG + Intronic
1087091162 11:94274569-94274591 CTCCAGCAGCAGAAGGAGAGAGG - Intergenic
1088592930 11:111418814-111418836 CTCCTGCAGACGTGGCAGAGAGG - Intronic
1089744387 11:120606857-120606879 CTGCTGGAGCAGTGGCATGGAGG + Intronic
1090075360 11:123577344-123577366 CTGCAGCGGCAGATGGAGAGAGG - Intronic
1090217580 11:124983759-124983781 TGCCAGCAGCAGTGGCAGCGTGG + Intronic
1090500102 11:127252805-127252827 CTGCACCAGCACAGTCAGAGTGG + Intergenic
1091061103 11:132462957-132462979 TTGCAGCAGCAGGTGCAGAGTGG - Intronic
1091105336 11:132913898-132913920 GAGCTGCAGCAGAGGCAGAGAGG - Intronic
1091111353 11:132971930-132971952 CGGCAGCAGCAGTAGCAGCAGGG - Intronic
1091116174 11:133015812-133015834 CAGCAGGAGCAAGGGCAGAGTGG - Intronic
1091280678 11:134380007-134380029 CTCCTCCAGCAGTGGCAAAGGGG - Intronic
1091413648 12:261386-261408 CTGAAAGAGCAGGGGCAGAGTGG - Intronic
1091656130 12:2348130-2348152 CTGCTGCAGGAGTGGGAGCGTGG + Intronic
1091703329 12:2678152-2678174 CTGCATTAGAAGTTGCAGAGTGG + Intronic
1092441420 12:8508490-8508512 CTGCAGTGGTAGTGGCAGAGGGG + Intergenic
1092579229 12:9820760-9820782 CTGCAACTGCAGTGGTGGAGGGG - Intergenic
1092579339 12:9821319-9821341 CTGCAGAGGCAGTGGCAGATGGG - Intergenic
1092587883 12:9919512-9919534 GTGCAGAGGCAGTGGCAGAGAGG + Intronic
1093498086 12:19780058-19780080 CTGTAGCTGCAGAGGCAGAGGGG + Intergenic
1093690184 12:22101556-22101578 AGGCAGAAGCAGTGGCAGAGAGG - Intronic
1093690194 12:22101611-22101633 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
1094587913 12:31794839-31794861 CTTCAGCTGGAGTGGGAGAGGGG - Intergenic
1094715104 12:33005999-33006021 CTGCAGAAAGAGAGGCAGAGTGG - Intergenic
1095835908 12:46638351-46638373 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1095890537 12:47231580-47231602 GTGAAGCAGCGGTGGCAGAAAGG - Intronic
1095916521 12:47485595-47485617 CAGCAGGTGCAGTGGCGGAGTGG + Intergenic
1096618507 12:52848048-52848070 CTGCAGCAACAGGGGTTGAGTGG - Exonic
1096789071 12:54034043-54034065 CTGCAGCCGGAGGGGCTGAGGGG - Intronic
1096863838 12:54549625-54549647 CGGCAGCAGCAGCGGCGGTGCGG + Exonic
1097313951 12:58152260-58152282 TTGCAGAATCAGTGGCAGATAGG - Intergenic
1098128474 12:67323560-67323582 CTGCAGAAGCAGTGGCAGAGAGG - Intergenic
1098465591 12:70783302-70783324 CTGCACAACCAGTAGCAGAGAGG - Intronic
1098632482 12:72740883-72740905 CTGCAGTAGCAGTGAGAGAGGGG - Intergenic
1098641131 12:72839418-72839440 CTGCTGTGGCAGTGGCAGAGGGG - Intergenic
1099719508 12:86342426-86342448 CTGCATAGGCAGTGGCAGAGAGG - Intronic
1099996167 12:89781396-89781418 TTGCAGCAGCAGTGTCAGATAGG + Intergenic
1100195905 12:92244149-92244171 CTGCAGGAACAGTGGCAGGAGGG - Intergenic
1100446343 12:94663852-94663874 CAGCACAAGCAGAGGCAGAGAGG - Intergenic
1101003649 12:100380786-100380808 CAGCAGTGGCAGTCGCAGAGTGG - Exonic
1101181803 12:102226940-102226962 CTGGAGTTGCAGTGGCACAGTGG + Intergenic
1101340895 12:103841189-103841211 GGGCAGCAGCAGTCGCAGAGCGG - Exonic
1101370957 12:104129852-104129874 CTCCAGCCTCAGTGACAGAGTGG + Intronic
1101375456 12:104167495-104167517 CTGCAACACCAGAGGCAGACAGG + Intergenic
1101725996 12:107388610-107388632 CTCCAGCAGGAGGGGAAGAGGGG - Intronic
1102347204 12:112167844-112167866 CAGCAGCAGCAGCGACAGCGAGG + Exonic
1102702130 12:114848638-114848660 CTGCAGAGGCAGTGGCTGTGTGG + Intergenic
1102746731 12:115255524-115255546 TGGCAGCACCAGTGACAGAGAGG + Intergenic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1104917046 12:132271140-132271162 CTGCGGCAGCAGTGGCCATGTGG + Intronic
1105704830 13:22962356-22962378 TGGGAGCAGCAGGGGCAGAGAGG + Intergenic
1105857791 13:24387514-24387536 TGGGAGCAGCAGGGGCAGAGAGG + Intergenic
1106443402 13:29801095-29801117 CTGCATCTGCAATGGCAGAGGGG - Intronic
1106881702 13:34138908-34138930 CCTCATCAGCAGAGGCAGAGAGG - Intergenic
1106890924 13:34244538-34244560 CTGCAGGGGCATGGGCAGAGAGG - Intergenic
1106951057 13:34884658-34884680 CTCCAGCCTGAGTGGCAGAGTGG - Intergenic
1107102568 13:36609908-36609930 CTGCACCAGCAGTGGCAGTATGG - Intergenic
1107175578 13:37394862-37394884 CTGCAGCTGCAGTGGGAGAGAGG - Intergenic
1107187997 13:37546769-37546791 CTGCAGCTGCAATGGCAGAAGGG + Intergenic
1107868975 13:44729725-44729747 CTGCAGTTGCAGAGGCAGAGTGG + Intergenic
1108248643 13:48542764-48542786 CTGCGGCAGCATTTGCAGGGGGG - Intergenic
1109476618 13:62887320-62887342 CATCAGCAGCAGTGGTAGAGTGG + Intergenic
1110035028 13:70672592-70672614 CTGCAGAGGCAGTGGCAAAGAGG + Intergenic
1110060636 13:71034061-71034083 CTGCAGTGGCAATGGCAGAGGGG - Intergenic
1110666363 13:78122163-78122185 CTGCCGCAGCAGAGGCAGATGGG - Intergenic
1110804156 13:79735793-79735815 CTGCAGCAACAGTGGAAGAAGGG + Intergenic
1111420140 13:88000480-88000502 CTGCATTGGCAGTGGCAGAAGGG + Intergenic
1111735590 13:92135050-92135072 CTGCAGCAGGAGAACCAGAGAGG - Intronic
1112493891 13:99890495-99890517 CTCCAGCATGAGTGACAGAGCGG - Intronic
1112738082 13:102443454-102443476 CTGCAGCTGCTGTGGGAGATGGG - Intergenic
1112803634 13:103138556-103138578 ATGTAAAAGCAGTGGCAGAGAGG + Intergenic
1113094199 13:106646460-106646482 CCTCAGCAGCAGATGCAGAGAGG + Intergenic
1113226931 13:108169257-108169279 CAGCAGAGGCAGTGGCAGAGAGG - Intergenic
1113949496 13:114064205-114064227 CTGCAGGAGCAGAGGCTGCGAGG + Intronic
1114059009 14:19001989-19002011 CTGCAAAGGCAGTGGCAGAAAGG - Intergenic
1114103534 14:19399765-19399787 CTGCAAAGGCAGTGGCAGAAAGG + Intergenic
1114183226 14:20382306-20382328 CTGCAGCAGCAGGGGGACAGTGG + Exonic
1114278707 14:21170278-21170300 CTGCAGAGGCACTGGCAGAGGGG - Intergenic
1114988888 14:28263358-28263380 CAGCAGAGGCAGTGGCAGAGAGG - Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1118286042 14:64474134-64474156 CTGCAACATGAGTGGCACAGAGG + Exonic
1118666417 14:68075344-68075366 CTGCAGTGGTACTGGCAGAGGGG + Intronic
1118666465 14:68075621-68075643 CTGCAGTGGCAGTGACAGAGGGG + Intronic
1118666529 14:68075896-68075918 CTGCAGCTGCAATGGCAGGGGGG + Intronic
1119758321 14:77134086-77134108 CTGCAGCTGCAGTGAGGGAGAGG + Intronic
1119784923 14:77305945-77305967 CTCCAGCAGCTGTGGCTGTGAGG + Intronic
1121018518 14:90563718-90563740 ATGCAGCAGCAGGGTTAGAGAGG - Intronic
1121020253 14:90575573-90575595 CTGCAGCACCAGTGGGAGGGGGG + Intronic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1121316186 14:92962252-92962274 GGGCAGGAGCAGTGGCAGTGAGG + Intronic
1121543519 14:94746426-94746448 CTCTAACAGTAGTGGCAGAGAGG - Intergenic
1121691533 14:95881043-95881065 CTGCAGTAGCAGTGGAAATGAGG - Intergenic
1121943784 14:98098888-98098910 CTGGGGCAGCAGAGGGAGAGGGG + Intergenic
1122174488 14:99906997-99907019 CTGCAGCAGGCATGGCACAGGGG - Intronic
1122275593 14:100589258-100589280 TGGCAGCAGCAGTGCCAGGGCGG - Intergenic
1122627770 14:103092912-103092934 CTGCAGCACCATCTGCAGAGGGG - Intergenic
1123496808 15:20834639-20834661 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1123554040 15:21408231-21408253 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1123590287 15:21845596-21845618 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1123798098 15:23794015-23794037 CTGAAGAAGCAGTTTCAGAGGGG + Intergenic
1123877894 15:24642504-24642526 CTGCAGCTGCAATGGCAGAAGGG - Intergenic
1123984457 15:25632848-25632870 CTGCAGAGGGAGAGGCAGAGTGG + Intergenic
1124163001 15:27291722-27291744 CTGCGTCCTCAGTGGCAGAGTGG + Intronic
1126225212 15:46262116-46262138 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1126233410 15:46354176-46354198 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
1126325551 15:47473240-47473262 CTGCCTCTGCAGTGGCTGAGGGG - Intronic
1127098350 15:55535748-55535770 CAGCAGCAGTAGTGGCATAGTGG - Intergenic
1127143375 15:55999674-55999696 GTCCAACAGCAGTGGCAGTGAGG + Intergenic
1127961555 15:63894405-63894427 CAGCATCAGCAGGGTCAGAGAGG + Intergenic
1128063264 15:64748436-64748458 CGGCAGCGGCAGTGGCAGTTGGG + Exonic
1128081024 15:64856990-64857012 CTGGAGAAGCAGGGGGAGAGGGG - Intronic
1128374181 15:67064269-67064291 CTGCAGCAGCAGCTGCGGATTGG + Intronic
1129172319 15:73815792-73815814 CTGGAGGAGCAGGGGCAGAAAGG - Intergenic
1129184725 15:73899164-73899186 CTGAAGTAGCCGTGGCCGAGAGG + Intergenic
1129372488 15:75106245-75106267 CTGCAGCAGCAAGAGCAGAATGG + Intronic
1129466783 15:75728563-75728585 CAGCAGCAGCAAAGCCAGAGCGG - Intergenic
1131192005 15:90324389-90324411 CTGCAGGAGCAGTTACAGAGCGG - Intergenic
1131535414 15:93233109-93233131 CTGCAGCTTCAGTGGGAGAAAGG - Intergenic
1132032858 15:98452524-98452546 CTGCTGCAGCAGAGCCAGAGAGG + Intronic
1132156927 15:99502343-99502365 CCGCAGGAGCAGTGGCAGCCAGG - Intergenic
1132240740 15:100255494-100255516 TAGAAGCAGCACTGGCAGAGGGG + Intronic
1132445318 15:101912426-101912448 CTGTAGAGGCAGTGGCAGAGGGG + Intergenic
1202962388 15_KI270727v1_random:135427-135449 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1132681309 16:1143190-1143212 TAGCAGCAGCAGTGGCAGTGAGG - Intergenic
1132797817 16:1733950-1733972 CGCCAGCAGCAGTGGCTGTGTGG + Intronic
1133017654 16:2951669-2951691 ATGCAGCACAGGTGGCAGAGGGG + Intergenic
1133033843 16:3023913-3023935 CTGCAGCAGCCCTTGCAGCGAGG - Exonic
1133125010 16:3641097-3641119 CAGCTGCAGCTGTGGCAGGGTGG + Intronic
1133264478 16:4575151-4575173 CTGCAGAAGAGGGGGCAGAGGGG - Intronic
1136403686 16:30031342-30031364 CAGCAGCTGCGGTGGCACAGGGG + Intronic
1136550446 16:30979846-30979868 CTGCAGCAGCAGCGGGAGGAGGG + Exonic
1136614257 16:31386993-31387015 TTGAAGCAGCAGTGGCAGCAAGG - Intergenic
1136777214 16:32878466-32878488 CAGAAGCAGCAGTGGCAGCTTGG - Intergenic
1136893409 16:33983047-33983069 CAGAAGCAGCAGTGGCAGCTTGG + Intergenic
1137533460 16:49299338-49299360 ACCCAGCAGCAGTGGCAGAATGG - Intergenic
1138004838 16:53323480-53323502 CTGCAGTAGCACTTGCAGATTGG - Intronic
1138756561 16:59493511-59493533 CTGAAGCAGAAGAGGAAGAGAGG - Intergenic
1139061893 16:63263238-63263260 CTGCAGTGGCAGTGGCAGAGGGG + Intergenic
1139061934 16:63263515-63263537 CTGCAGCTGCAATGTCAGAAGGG + Intergenic
1139459410 16:67109967-67109989 CTGCAGCAGCCGCGGCAGCGGGG - Exonic
1139734138 16:68972884-68972906 GAGCAGCAGCAGATGCAGAGGGG + Intronic
1139910599 16:70395167-70395189 CTGCAGCATCTGTGGAAGGGAGG + Exonic
1140471393 16:75217295-75217317 CTCCAGCAGCGGTGGGAGTGGGG + Intergenic
1140820795 16:78661243-78661265 CTCCAGCAGCAGCAACAGAGAGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141176194 16:81720838-81720860 CTGGACCATCAGTGACAGAGGGG + Intergenic
1141247869 16:82327311-82327333 CTACAGCTGCAGTGGCAAACAGG - Intergenic
1141527202 16:84618756-84618778 CTGCAGCCTCAGGGGCAGGGGGG - Intergenic
1141873421 16:86805371-86805393 CTGCAGTGGAAGGGGCAGAGTGG - Intergenic
1142226024 16:88877995-88878017 CTGCTGCTGCAGTGGCAGTGAGG - Intronic
1203079628 16_KI270728v1_random:1140575-1140597 CAGAAGCAGCAGTGGCAGCTTGG - Intergenic
1142740688 17:1930298-1930320 CTGCAGAAGCAGTGGCTGGCGGG + Intergenic
1142923039 17:3207765-3207787 CTGGAGAAGCAGTGGCAGGATGG - Intergenic
1143548503 17:7614568-7614590 CTGCAGCAGCAGTCTGAGTGCGG + Exonic
1143882449 17:10040028-10040050 CTGCTGCAGGAGTGGCTGTGAGG + Intronic
1145028488 17:19486998-19487020 CTCCAGAAGCAGTGTCTGAGAGG + Intergenic
1145718974 17:27050266-27050288 CTGCAGTAGTAATGGCAGAAGGG - Intergenic
1145991125 17:29080102-29080124 CATCAGCAGCAGAGGCGGAGCGG + Intronic
1145991383 17:29081147-29081169 CGGCAGCAGCCCTGGCAAAGTGG + Intronic
1146595857 17:34168080-34168102 CTGCACCAGCAGTGGCACTATGG - Intronic
1146751897 17:35389475-35389497 CTGCAGAGGCAGTGGCAGAGGGG + Intergenic
1146751947 17:35389754-35389776 CTGCTGTGGCAGTGGCAGAGGGG + Intergenic
1146789013 17:35741325-35741347 CTGCACCGGCACTGGCCGAGCGG + Exonic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1147403618 17:40195350-40195372 GTGCATCAGCAGTAGCAGGGAGG - Exonic
1147777226 17:42910907-42910929 CTGCAACAGCAATGCCTGAGTGG - Exonic
1147833664 17:43314988-43315010 ATGCAGAAGCTGAGGCAGAGAGG - Intergenic
1148218308 17:45845859-45845881 CAGCAGAGGCAGCGGCAGAGAGG - Exonic
1149092542 17:52801464-52801486 CAGCAGTAGCAGTAGCAGATTGG - Intergenic
1149601968 17:57898990-57899012 CAGCAGGAGCACAGGCAGAGTGG + Intronic
1150318310 17:64188335-64188357 CAGCAGCAGCAAAGGCAGTGTGG - Exonic
1150470915 17:65436920-65436942 CTGCAGCTGTAGTTGGAGAGAGG - Intergenic
1151139487 17:71977795-71977817 CTGCAGCAGCTGTACCAGACTGG + Intergenic
1151285753 17:73109842-73109864 CAGCAGCAGCAGCGACAGAAAGG + Intergenic
1152102305 17:78309244-78309266 CTGCAGCAGCCCTGGCAGGTAGG + Intergenic
1152447488 17:80354275-80354297 CAGCAGAAGCAGTGACACAGTGG + Intronic
1152491075 17:80635140-80635162 GAGGAGCAGCAATGGCAGAGAGG - Intronic
1153004345 18:483943-483965 CTGCTGCAGAGGTGGCACAGTGG - Intronic
1153399435 18:4667039-4667061 CACCTGCAGCAGTGGCACAGTGG - Intergenic
1153411966 18:4803277-4803299 CTGCAGCAGCAGGGCAAGAGTGG + Intergenic
1153424269 18:4945294-4945316 TTGCAACTGCAATGGCAGAGTGG - Intergenic
1153738263 18:8095578-8095600 CTGCAGCAGCAATGGAGGATGGG + Intronic
1154019198 18:10647829-10647851 TTGCTGCAGCAGTGACAGGGTGG - Intergenic
1154019271 18:10648242-10648264 CAGCAGCAGCAGCAGCATAGTGG - Intergenic
1154181363 18:12142487-12142509 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1154181651 18:12144151-12144173 CTGTAGAGGCAGTGGCAGAGAGG + Intergenic
1154182253 18:12147433-12147455 CTGTAGAGGCAGTGGCAGAGAGG - Intergenic
1154182541 18:12149097-12149119 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1154185018 18:12175395-12175417 TTGCTGCAGCAGTGACAGGGTGG + Intergenic
1154454711 18:14510323-14510345 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
1154470170 18:14693089-14693111 CTGCAGCAGTAATGGCAAAAGGG + Intergenic
1155133026 18:22957661-22957683 TAGCAGCAGCAGTGGAAGATAGG + Intronic
1155172114 18:23274659-23274681 CTAGGGCAGCAGTGGCAGTGGGG - Intronic
1155317978 18:24591192-24591214 CTCCAACAGCAGTAGTAGAGTGG + Intergenic
1155433369 18:25785615-25785637 CGGCATCAGCAGAGGCAGAGGGG - Intergenic
1155577016 18:27259270-27259292 CTGCAGAGGCAGTGGCAGAAAGG + Intergenic
1155708559 18:28847248-28847270 CTGCAGTTACAGTGGAAGAGAGG - Intergenic
1155708603 18:28847529-28847551 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
1155779388 18:29811786-29811808 CAGCAGCAGCAGTAGCACAGTGG - Intergenic
1155944225 18:31829514-31829536 CATAAGCAGCAGTTGCAGAGAGG + Exonic
1156482530 18:37445229-37445251 CTGCAGAAGCGGGAGCAGAGGGG + Intronic
1156855064 18:41772293-41772315 ATGCAGCAGCAGTAGCAGCTGGG + Intergenic
1156896885 18:42256498-42256520 TCACTGCAGCAGTGGCAGAGTGG + Intergenic
1157357222 18:46946962-46946984 CCGCAGCAACAGTAGGAGAGGGG - Intronic
1157461627 18:47902138-47902160 CTGCAGCCTGAGTGGCAGATTGG - Intronic
1157473519 18:48007586-48007608 CTGGAGCAGGAGTGGCACTGAGG + Intergenic
1159083418 18:63760689-63760711 CTGCTCCAGCAGTGGCTGAAAGG + Intronic
1159497382 18:69223659-69223681 CTTCAACAGCTGTGCCAGAGGGG - Intergenic
1159832240 18:73291257-73291279 CTGAAGGACCAGTGGAAGAGTGG + Intergenic
1159921072 18:74227822-74227844 CAGCAGCAGCAGCAGCAGAAAGG + Intergenic
1160299753 18:77668971-77668993 CTGGAGCAGCAGTGGTACCGTGG - Intergenic
1160365257 18:78319225-78319247 CTGCAGAAGCAGGAGAAGAGAGG - Intergenic
1160377369 18:78423185-78423207 CAGCAGCAGCAATAGCAGGGGGG - Intergenic
1160402081 18:78618606-78618628 CTGCAGCTGCATTGTCAGTGAGG + Intergenic
1160455505 18:78996192-78996214 TCGCAGCAGCAGCGGTAGAGCGG + Intronic
1160639991 19:121281-121303 CTGTAGAGGCAGTGGCAGAGGGG - Intergenic
1160858683 19:1228560-1228582 CGGCAGCAGCGGTGGCGGCGCGG + Exonic
1160865099 19:1252850-1252872 CAGCAGCAGCAGTGGCGTGGGGG + Intronic
1161014436 19:1976682-1976704 CTGCAGCTGGACTGGCAGGGTGG - Intronic
1161025253 19:2033831-2033853 CTGCAGCTGCAGTGGGAGGGAGG - Intronic
1161337625 19:3722824-3722846 CTCCAGGAACAATGGCAGAGAGG - Intronic
1161953838 19:7482212-7482234 CTGCAGGACCAGGAGCAGAGGGG + Intronic
1162066994 19:8131830-8131852 CTGCAGAAGCAGTGGCGGCACGG + Intronic
1162241986 19:9362705-9362727 CTGCAGCCGCAGAGGGAAAGGGG - Intronic
1162461560 19:10816924-10816946 CTGGAGCAGCAGTGGGAGAAGGG + Intronic
1162536159 19:11263761-11263783 CTGCAGCAGTGCTGGGAGAGAGG - Intergenic
1163265249 19:16217006-16217028 CAGCAGCAGTAGTGGCAGTATGG + Intronic
1163442063 19:17327343-17327365 GTGCTGCAGGGGTGGCAGAGAGG + Exonic
1163442956 19:17330745-17330767 CTGCAGGAGCAAAGGCAGAGAGG - Intronic
1164251728 19:23483125-23483147 CTGAAGCTGCTGTGGCAGATGGG - Intergenic
1164495291 19:28754820-28754842 GTGCACCAGCAGTGGCAGGGTGG - Intergenic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165293548 19:34907843-34907865 CTGCAGAAGCAGTGGTAGGTGGG - Intergenic
1165740626 19:38203294-38203316 CTGCAGCTGCAGAGGGAGATGGG - Intronic
1165968166 19:39602331-39602353 ATGCAGCAGAAGTGACAGTGGGG - Intergenic
1166368480 19:42289158-42289180 CTGCAGGATAGGTGGCAGAGAGG - Intronic
1166748339 19:45152509-45152531 CTGCAGCAGCAGCAGCAGCAGGG - Exonic
1166777450 19:45321825-45321847 CTCCAGCAGCGGTGGGAGACGGG + Intronic
1166911695 19:46163617-46163639 CTGCAGAGGCAGTGGCAGAGGGG + Intergenic
1167285900 19:48598901-48598923 CTGCAGTAGCAGAGGCAGTGAGG + Intronic
1167591575 19:50407035-50407057 CAGCAGCCGCAGTGGCAGGTAGG - Exonic
1167632256 19:50632426-50632448 CAGCAGCAGCAGTGGCCGCTGGG - Exonic
1167748965 19:51368571-51368593 CTGCAGCCTCAGTGGCATGGGGG - Exonic
1167771889 19:51525863-51525885 CTGCAGCAGCAATGGCAGAGGGG - Intronic
1168063630 19:53907604-53907626 CTCCAGCAGCTGTGGCCGGGTGG - Exonic
1168269163 19:55240292-55240314 CTGCAGCAGCTGCGGGAGAGCGG + Exonic
925202020 2:1975295-1975317 ATCCCGCAGCTGTGGCAGAGAGG + Intronic
925592727 2:5526355-5526377 GTACAGCAGCAGTAGCAGACCGG - Intergenic
925646830 2:6044666-6044688 CTGCAGCTGCAGTGGTGGAGGGG - Intergenic
925646945 2:6045223-6045245 CTGCAGAGGCAGTGGCAGAGGGG - Intergenic
925759206 2:7168159-7168181 CTGCAGCAGGAGGGTGAGAGTGG + Intergenic
926115762 2:10212260-10212282 CAGCAGCAGCAGCAGCAGAAGGG - Intergenic
926201481 2:10802765-10802787 CTGCAGCAGGAAGGGCAGAGGGG - Intronic
927400342 2:22703697-22703719 CAGCAGCAGCAGTGGCAGTGGGG - Intergenic
927523958 2:23720720-23720742 AGGCATCAGCAGTGGCAGTGGGG - Intergenic
927895915 2:26781801-26781823 CTGCAGTATCTGTGGCAGAATGG - Intronic
928097269 2:28412379-28412401 CCGCAGAAGCAGTAGCAGCGGGG + Exonic
929604360 2:43225373-43225395 CTGCAGCAGCAGCAGAAGGGGGG - Exonic
929604396 2:43225533-43225555 CGGCAGCAGCTGCGGCAGCGCGG - Exonic
929978183 2:46655025-46655047 CTTCTGCAGCTTTGGCAGAGGGG - Intergenic
929998480 2:46845186-46845208 ATGGAGCAGCAGTTGAAGAGAGG + Intronic
930092583 2:47541987-47542009 CAGCAGCAGCAGCGGCAGCAGGG + Intronic
930229447 2:48828048-48828070 CTGCAGAGGCAGTGGTAGAGAGG - Intergenic
930304824 2:49665231-49665253 CCGCAGAAGCAGTGGCAGAGGGG + Intergenic
930599146 2:53423885-53423907 CTGCAGCTCCAGTGGCAGTAGGG + Intergenic
930812599 2:55558876-55558898 CATTAGCAGCACTGGCAGAGTGG + Exonic
930839147 2:55826134-55826156 CTGCAGTGGCAGTGGCAGAGGGG - Intergenic
931489093 2:62725288-62725310 CAGCAGCGGCTGTGGCAGTGTGG + Intronic
931543390 2:63354035-63354057 CTGTAGAGGCAGTGGCAGAGAGG - Intronic
931889971 2:66661351-66661373 CAGCAGCTGCAGTGGCAGTGAGG + Intergenic
932083751 2:68739092-68739114 CTTCTGCAGCAGCAGCAGAGTGG + Intronic
932476194 2:72007647-72007669 GGGCAGCAGCAGGGGCAAAGTGG + Intergenic
932819556 2:74887795-74887817 GTGCATCAGCAGTGGCAGACAGG - Intronic
933051833 2:77610893-77610915 CCGCATTGGCAGTGGCAGAGGGG - Intergenic
933080256 2:77976842-77976864 CTGAAGCTGCAATGGCAGAGGGG - Intergenic
933080341 2:77977348-77977370 CTGCTATGGCAGTGGCAGAGGGG - Intergenic
933484193 2:82897144-82897166 CTTCAGTGGCAGTGGCAGAGGGG - Intergenic
933707452 2:85302629-85302651 CTGCAGCAGCACTGCCTGAGTGG - Intronic
933764487 2:85697483-85697505 CTGCAGCAGCAGCACCACAGTGG - Intronic
933839383 2:86274367-86274389 ATGCTGCAGCCATGGCAGAGAGG + Intronic
934564910 2:95333410-95333432 CCGCAGCAGTAGTGGTAGAATGG - Intronic
934623213 2:95829035-95829057 CTGCAGAAGCAGTGGCAGAGAGG + Intergenic
934681215 2:96285234-96285256 CTGCAGCAGCATTCGCAGGATGG + Exonic
934810553 2:97273058-97273080 CTGCAGAAGCAGTGGCAGAGAGG - Intergenic
934827139 2:97434881-97434903 CTGCAGAAGCAGTGGCAGAGAGG + Intergenic
935106605 2:100050779-100050801 CTGCATCTGCAGGGGCAGTGTGG - Intronic
935557722 2:104528561-104528583 CAGCATCAGGATTGGCAGAGAGG - Intergenic
935834671 2:107037365-107037387 CAGCAGATGCAGTAGCAGAGAGG - Intergenic
936925224 2:117730280-117730302 ATGCCCCAGCAGTGGCTGAGGGG + Intergenic
937024073 2:118682873-118682895 CAGCAGCAGCAGCAGCACAGAGG - Intergenic
937145303 2:119639142-119639164 CTGCAGCAGCAGTGGGCCAAGGG - Intronic
937379637 2:121365112-121365134 CTCCAGCAGCAGGAGCAGAATGG + Exonic
937397192 2:121547260-121547282 CCGCAGCGGCAGTGGCAGAGAGG - Intronic
937521007 2:122712255-122712277 CTGCAGAGGCAGTGACAGAGAGG - Intergenic
938187628 2:129245971-129245993 ATTCAACAGCATTGGCAGAGAGG + Intergenic
938282181 2:130072241-130072263 CTGCAGAGGCAGTGGCAGAAAGG + Intergenic
938332808 2:130460813-130460835 CTGCAGAGGCAGTGGCAGAAAGG + Exonic
938357000 2:130659858-130659880 CTGCAGAGGCAGTGGCAGAAAGG - Intergenic
938433436 2:131266664-131266686 CTGCAGAGGCAGTGGCAGAAAGG - Intronic
938477477 2:131629247-131629269 CTGCAGAGGCAGTGGCAGAAAGG - Intergenic
939174800 2:138736447-138736469 CTGCTGCAGCTGTGGCTGACAGG - Intronic
939275481 2:139992255-139992277 CTGCAGCCGCAATGAGAGAGGGG + Intergenic
939560037 2:143721141-143721163 CAGCAGCAGCAGTGGCACCTGGG - Intronic
940446697 2:153785566-153785588 CTGCAGTGGCAGTGGCAGAGGGG + Intergenic
940446918 2:153786757-153786779 CTGCAGTGGCAGTGGCAGAGGGG - Intergenic
940449962 2:153824834-153824856 CTGGAGCAGGAGGGACAGAGAGG - Intergenic
940506015 2:154554165-154554187 CAGCAGCATCTGTGGGAGAGTGG + Intergenic
940531708 2:154886335-154886357 CAGCAGCTGCAGTAGCACAGTGG + Intergenic
941106502 2:161360385-161360407 CTCCAGCCTCAGTGACAGAGCGG - Intronic
941253665 2:163200067-163200089 CTACTGCACCAGTTGCAGAGAGG - Intergenic
941527843 2:166628522-166628544 CTGCAGAGGCAGTGGCCAAGGGG + Intergenic
941527892 2:166628799-166628821 CTGCTGTGGCAGTGGCAGAGGGG + Intergenic
941933238 2:170963422-170963444 CAGCAGCAGCAGTAGCAGCGGGG - Intronic
942480390 2:176381550-176381572 CTGAAGCAGGTGTGGCAGGGAGG + Intergenic
942530963 2:176909815-176909837 CCTCAGGGGCAGTGGCAGAGAGG + Intergenic
943276642 2:185876213-185876235 TGGCAGCAGCATTGGCAGTGGGG - Intergenic
943611893 2:190044516-190044538 CTGCAGAGGCAGTAGCAAAGAGG + Intronic
943928390 2:193818964-193818986 CTGAAGCTGCTGTGGCAGGGTGG + Intergenic
944471221 2:200055449-200055471 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
944471301 2:200055930-200055952 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
945016295 2:205520420-205520442 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
946157134 2:217814393-217814415 GTCCTGCTGCAGTGGCAGAGTGG - Intronic
947263491 2:228251551-228251573 TGCCAGCAGCAGTGGCAGTGGGG + Intergenic
947399054 2:229714358-229714380 CAGCAGCAGCAGGGCCAGCGCGG + Exonic
947463874 2:230324722-230324744 CTGCAGCAACAGTGCCACTGGGG - Intergenic
947885834 2:233570277-233570299 CTGTTTCAGGAGTGGCAGAGGGG - Intergenic
948450819 2:238070096-238070118 CTGCAGCAGCAGTGGCCTTGTGG + Intronic
948791214 2:240377859-240377881 CTCCCGCTGCAGGGGCAGAGAGG + Intergenic
949070318 2:242020560-242020582 CTGCAGCTGCAGACCCAGAGAGG + Intergenic
1169151660 20:3294181-3294203 CTGCAGCAGCACAGGAAGATGGG + Exonic
1170013328 20:11752138-11752160 CTGCAGCAACAGGGGAAGACAGG - Intergenic
1170086256 20:12535573-12535595 CTGCAGCTGCTGTGGCAGATGGG - Intergenic
1170221672 20:13947870-13947892 CACCAGCTGCTGTGGCAGAGTGG - Intronic
1170545592 20:17433505-17433527 CAACAGGAGCAGAGGCAGAGAGG + Intronic
1170792966 20:19522726-19522748 CAGCAACACCAGTTGCAGAGAGG - Intronic
1170863158 20:20127862-20127884 CTGCAGCTGCTGTGGGAGATGGG + Intronic
1170904056 20:20496014-20496036 CATGAGTAGCAGTGGCAGAGTGG + Intronic
1172070270 20:32251649-32251671 CTTCAGCAGCAGAGACAGGGAGG + Intergenic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1172729396 20:37072981-37073003 CTGCAGCCTGAGTGACAGAGCGG - Intronic
1174180314 20:48670295-48670317 CAGCAGGGGCAGGGGCAGAGAGG - Intronic
1174215338 20:48912054-48912076 AGGAAGCAGCAGTGGAAGAGTGG + Intergenic
1174929203 20:54794503-54794525 CTGCAGCTGCAATGGCAGAGGGG + Intergenic
1175116132 20:56683811-56683833 CTGGAGCAGAAGCAGCAGAGAGG + Intergenic
1175687413 20:61041615-61041637 CTCCAACAGCAGTGGCAAATGGG + Intergenic
1175692239 20:61073861-61073883 CTCAAGCAGCATTGGCAGTGTGG - Intergenic
1175929134 20:62485360-62485382 CTGCAGCAGCTGTGGCTGCTCGG - Intergenic
1176021556 20:62964830-62964852 CTGGAGCAGCAGAGGAAGTGGGG + Intronic
1176030386 20:63008648-63008670 CACCGGCAGCAGTGCCAGAGTGG - Intergenic
1176720166 21:10386179-10386201 CTCCAGCCTGAGTGGCAGAGTGG + Intergenic
1176804326 21:13464776-13464798 CTGCAGCAGTAATGGCAAAAGGG - Intergenic
1176819453 21:13642985-13643007 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1178352200 21:31880189-31880211 CTGCAGCAGCCCTGGTGGAGGGG + Intronic
1178430291 21:32512727-32512749 CGGCAGCATCACTGGCAGTGGGG + Intronic
1178728227 21:35074298-35074320 CAGAAGCATCAGTGTCAGAGTGG + Intronic
1179085106 21:38209182-38209204 CTGGAGCAGCAGGAGCAAAGGGG + Intronic
1179286556 21:39982804-39982826 CTGCATTAGCAATGGCACAGAGG - Intergenic
1179439056 21:41380544-41380566 CTGCAGCAGCATTTCCAAAGGGG - Intronic
1179461415 21:41537980-41538002 CTGCAGAAGCAGAGACAGACGGG - Intergenic
1180018158 21:45101011-45101033 CAGCAGCAGCAGCGCCAGTGCGG + Intronic
1180076920 21:45467739-45467761 CTGCTCCAGCAGGGTCAGAGTGG + Intronic
1180146953 21:45926928-45926950 GTGCAGCAGGAGTGACAGACAGG + Intronic
1180181009 21:46118682-46118704 CTGCAGGCGAAGAGGCAGAGGGG - Intronic
1180215055 21:46318434-46318456 GGGCAGCAGCTGAGGCAGAGGGG + Intronic
1180477493 22:15724605-15724627 CTGCAAAGGCAGTGGCAGAAAGG - Intergenic
1180740853 22:18052400-18052422 CAGCAGCAGCAGAGGCACCGGGG + Intergenic
1180863896 22:19104881-19104903 AAGCAGCAGCAGCAGCAGAGGGG + Intronic
1181104281 22:20564333-20564355 CAGCGGCAGCCGTGGCAGTGGGG + Intronic
1182118683 22:27773179-27773201 CGGTAGCAGCTGTGGAAGAGGGG - Intronic
1182445116 22:30385496-30385518 CAGCAGCAGCAGTGGCAACGGGG + Intronic
1182453621 22:30435678-30435700 GTGCACCAGCAGGGGCAGGGAGG - Intergenic
1182557453 22:31136914-31136936 GTGCAGTTGCAGTGGAAGAGGGG + Exonic
1182888755 22:33798599-33798621 TTGGAGCAGCAGTGCCAGCGTGG - Intronic
1182904155 22:33921397-33921419 CCGCAGCTGCCGTGGTAGAGAGG + Intronic
1183041717 22:35184901-35184923 CTGCAGAGGCAGTGGTGGAGAGG - Intergenic
1183057369 22:35315192-35315214 GGGCAGGGGCAGTGGCAGAGGGG + Intronic
1183316964 22:37142180-37142202 CAGCAGGAGCAGAGGCAGAATGG + Intronic
1183616139 22:38946915-38946937 CTGGAGGAGGAATGGCAGAGCGG + Intergenic
1183718909 22:39550776-39550798 AAGCAGCAGGAGTGGCAGAAAGG + Intergenic
1183816016 22:40301186-40301208 CAGCAGCAGCAGAGGCAGCCAGG + Exonic
1184102402 22:42347719-42347741 CAGCGCCAGCAGGGGCAGAGGGG + Intergenic
1184556956 22:45238672-45238694 GTTCAGCAGCAGGGGAAGAGGGG + Intronic
1184839941 22:47046667-47046689 CAGCAGCAGCTCTGGCAGAAAGG - Intronic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
1184981213 22:48097147-48097169 AGGCAGCAGGAGTGGCAGGGTGG - Intergenic
1185021565 22:48379707-48379729 CTTCAGAGGAAGTGGCAGAGTGG + Intergenic
1203296105 22_KI270736v1_random:44445-44467 CAGAAGCAGCACAGGCAGAGGGG - Intergenic
949376867 3:3400565-3400587 TGGCAGCAGCAGTGGCAGTGGGG + Intergenic
949436806 3:4038455-4038477 CTACAGAGGCAGTAGCAGAGTGG + Intronic
949436857 3:4038740-4038762 CTGCTGTGGCAGTGGAAGAGAGG + Intronic
949847120 3:8383039-8383061 CTGTAGCAGGAGTGGCAGAGAGG + Intergenic
950255118 3:11498352-11498374 CTTCAGCAGCAGTGCCATACAGG - Intronic
950276795 3:11668421-11668443 CAGCAGCATCAGTGGCAGCTGGG + Intronic
950601005 3:14035470-14035492 CTGCAGAAGCAGTGGCAGAAAGG + Intronic
950749758 3:15119325-15119347 CTACCACAGCTGTGGCAGAGGGG + Intergenic
951078507 3:18425122-18425144 CAGCAGGAGCAGCGGCGGAGAGG - Intronic
951197064 3:19836196-19836218 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
951283412 3:20780011-20780033 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
952644648 3:35640087-35640109 CAGCAGCAGCAGGGGCAGCGGGG + Intronic
952744470 3:36764290-36764312 CTGGAGCAGAGGTGGCAGCGCGG + Intergenic
952841811 3:37652938-37652960 CAGCAGCAGCATTTGGAGAGGGG - Intronic
953185298 3:40631789-40631811 CTGCAGCTGCTGTGGGAGATGGG - Intergenic
953568279 3:44051569-44051591 CAGCAGCACCAGTGCCAGGGAGG - Intergenic
954304490 3:49718231-49718253 CGGCGGCAGCAGCGGCAGGGTGG + Exonic
954486766 3:50860288-50860310 TTGCAGAAGCAGTGCCAGAGAGG + Intronic
954498663 3:50988933-50988955 CTGCAGAAACAGTGCCAGAGAGG - Intronic
954658282 3:52211376-52211398 CAGCAGCATGGGTGGCAGAGAGG - Exonic
954809346 3:53238554-53238576 CTGCAGCAGAAGTGCCATAGTGG - Intronic
955081473 3:55661466-55661488 AGGCAGCAGAAGAGGCAGAGAGG - Intronic
955659170 3:61278130-61278152 TTGCAGTAGCAGTGGCACAAGGG + Intergenic
955778805 3:62462242-62462264 CTTCAGCAGCAGTAGCAGCCTGG - Intronic
955864849 3:63371841-63371863 CTGCAGTTCCAGTGGCAGACGGG - Intronic
955864903 3:63372119-63372141 CTGTCGTGGCAGTGGCAGAGGGG - Intronic
955864944 3:63372395-63372417 CTGCAGTGGCAGTGGCAGAGGGG - Intronic
955951940 3:64251360-64251382 ATGCAGAAGTGGTGGCAGAGTGG - Intronic
956193468 3:66629574-66629596 CTGCAGCAGCAGCAGCGGGGAGG + Intergenic
958460099 3:94383647-94383669 GTGCAGCAGCAGTGGGACAGTGG - Intergenic
958678599 3:97296618-97296640 CAGCAGCAGCAGTGGCAGTGAGG + Intronic
958838316 3:99172188-99172210 CTGTAGGTGCAATGGCAGAGAGG - Intergenic
959094462 3:101938584-101938606 CTACAGCAGCAGGGTCAGAGGGG - Intergenic
959104589 3:102051609-102051631 CTGCTCCAGCAGTGGCTGAAAGG + Intergenic
959262822 3:104103030-104103052 GTGCAGTGGCAGTGACAGAGGGG + Intergenic
959262922 3:104103599-104103621 CTGCAACTGCAATGGAAGAGGGG + Intergenic
959520202 3:107316601-107316623 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
959950400 3:112174741-112174763 CTGCAACTGTAGTAGCAGAGGGG + Intronic
960688146 3:120314234-120314256 CTGCAGCAGCAGCAGCAGCATGG - Intergenic
960841572 3:121963896-121963918 CTGCAGAAGCAGTGACAGAGAGG - Intergenic
961331017 3:126138016-126138038 CGCTAGCAGCAGTGGCAGTGGGG + Intronic
961663564 3:128482982-128483004 CTGCAGCCGCGGGGGCAGGGAGG + Intronic
961781132 3:129320542-129320564 CTGCAGCAGCAGCGGATGGGAGG + Intergenic
961988117 3:131158689-131158711 CAGCAGCAGCAGAGACAGAATGG - Intronic
963053027 3:141158502-141158524 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
963082276 3:141404924-141404946 CTTCTCCAGCAGTTGCAGAGTGG + Intronic
965113065 3:164451698-164451720 CTACAGGAACAGTGGCAGAGGGG + Intergenic
965317809 3:167212400-167212422 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
965811025 3:172592039-172592061 CTACAGAGGCAGTGGCAGAGAGG + Intergenic
966152304 3:176877859-176877881 CTGCTGTGGCAGTGGCAGCGGGG - Intergenic
966152355 3:176878133-176878155 CTGCACAGGCAGTGGCAGAGGGG - Intergenic
966361820 3:179137803-179137825 CTTCAGCTGCAGTGGCAGAGTGG - Intergenic
967528187 3:190518169-190518191 CTGTAGCAGCTGTGGTAGTGTGG + Intronic
967621805 3:191642691-191642713 CTGCAGTGTCAGTGGCAAAGGGG - Intergenic
968096512 3:195934468-195934490 CTCCAGCCTGAGTGGCAGAGTGG + Intergenic
968131655 3:196195908-196195930 CTGCATCACCAGCGGTAGAGAGG + Intergenic
968349595 3:198042580-198042602 CTGCAGCTGTAGTGGAAGTGAGG + Intronic
968511950 4:999717-999739 CTGCAAGTGCAGTGGCAGGGCGG + Intronic
968511971 4:999803-999825 CTGCAAGTGCAGTGGCAGGGCGG + Intronic
968511992 4:999889-999911 CTGCAAGTGCAGTGGCAGGGCGG + Intronic
968512015 4:999976-999998 CTGCAAGTGCAGTGGCAGGGCGG + Intronic
968512059 4:1000149-1000171 CTGCAAGTGCAGTGGCAGGGTGG + Intronic
968558056 4:1260119-1260141 CTGCAAAAGCAGTGCCACAGGGG - Intergenic
968961953 4:3750171-3750193 CTGCAGCAGCAGGGACAGAAGGG + Intergenic
969222162 4:5768074-5768096 TTGCAGCAGCAGCAGCAGTGAGG + Intronic
969481915 4:7451282-7451304 CAGCAGCAGCAGCGGCAGTGGGG + Intronic
969677858 4:8624653-8624675 CTGCAGAGGCAGTGAGAGAGTGG - Intergenic
969678813 4:8630289-8630311 CTGCAGAGGCAGTGAGAGAGTGG - Intergenic
969679769 4:8635939-8635961 CTGCAGAGGCAGTGAGAGAGTGG - Intergenic
970200564 4:13600366-13600388 TTGCTGCAGCAGTGGAAGAAAGG - Exonic
970539152 4:17060019-17060041 CTGGAGCAGCAGTGGCATACAGG + Intergenic
970574781 4:17416684-17416706 CTGTAGAGGCACTGGCAGAGTGG - Intergenic
971106013 4:23524807-23524829 CTGCAGAGGCAGTGGCAAAGAGG - Intergenic
971219120 4:24688821-24688843 CTGTACCAGAAATGGCAGAGGGG - Intergenic
971605311 4:28651224-28651246 CTGCAGAGGCAGTGACAGAGGGG + Intergenic
972083432 4:35182708-35182730 CAGCAGCAGCAGTAGCAGTGTGG - Intergenic
972125529 4:35760621-35760643 CTGCAGCAGCACTGGCAGAGGGG - Intergenic
972187931 4:36554458-36554480 TTGCAGCAGAACTGGCAGACAGG + Intergenic
972828355 4:42786965-42786987 CTGCAGCAGCAATGGCAGAAGGG + Intergenic
974184602 4:58430231-58430253 CTGCAGAGGCAGTGACAGAGAGG + Intergenic
974199879 4:58623652-58623674 CTGCAGAGACAGTGACAGAGAGG - Intergenic
974985940 4:69026272-69026294 CTGCAGATGCAGTGGCTGAGAGG + Intronic
975022125 4:69502727-69502749 CCACAGAAGCTGTGGCAGAGAGG - Intronic
975059418 4:69978798-69978820 CTGCAGCGGCATTGGCAGAGAGG + Intergenic
975106174 4:70571531-70571553 TTGCAGAGGCAGTGGCAGAGAGG + Intergenic
975109575 4:70608594-70608616 CAGCAGCAACAGTGGAAGAATGG + Intergenic
975251089 4:72178472-72178494 CTGAACCAACAGTGGCAAAGTGG - Intergenic
975389814 4:73802897-73802919 CTGTAGCAGCAGTGGAAAAGGGG - Intergenic
975404028 4:73968810-73968832 CTGCAGCTGCAATGGCCAAGAGG - Intergenic
975404127 4:73969366-73969388 CTGCAGTGGCAGTGGTAGAGGGG - Intergenic
975511117 4:75194415-75194437 CAGCGGCAGCAGTGGCAGTGTGG - Intergenic
975525898 4:75350521-75350543 CTGCAGCAGCAAAGGCTGTGGGG - Intergenic
976141001 4:81991497-81991519 CAGCAGCAGCAGTGGGGGTGGGG + Intronic
976357572 4:84137131-84137153 GTGCAGAAGCAGAGGCAGGGTGG - Intergenic
976481897 4:85555991-85556013 CTGCAATGGCAGTGGCAGAGGGG + Intronic
976954662 4:90880556-90880578 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
977002268 4:91519027-91519049 CTGCATCTGCAATGGCAAAGGGG + Intronic
977006268 4:91571997-91572019 CAGCAGAGGCAGTGGCAGAGAGG + Intronic
977417302 4:96749471-96749493 CTGCTCCAGCAGTGGCTGAAAGG - Intergenic
977649529 4:99454034-99454056 CTGCAGAGGCAGTGGTAGAAAGG + Intergenic
977729319 4:100332027-100332049 ATGCAGAGGCAGTGGCTGAGAGG - Intergenic
977819853 4:101458734-101458756 CTGCAGAGGCACTGGCAGAGAGG - Intronic
977971440 4:103218283-103218305 CTGCAACTGCAGTGGCAGAGGGG - Intergenic
977979623 4:103306935-103306957 CTTCAGTGGCAGTGACAGAGCGG + Intergenic
978043046 4:104093000-104093022 CTGCAGAGGCAATGGCAGAAAGG - Intergenic
978208243 4:106105063-106105085 CTGCAGAGACAGTGGCAGAGAGG - Intronic
978271274 4:106893461-106893483 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
978608103 4:110504400-110504422 TTGCAGCAGCCATGGCAGAGGGG + Intronic
978683730 4:111414802-111414824 ATGCAGAGGCAGTGGCAGAGAGG + Intergenic
978923758 4:114217637-114217659 CAGCAGTGGCAGTGGCAGAAGGG - Intergenic
978923777 4:114217731-114217753 CAGCAGCAGCATAGGCAGTGTGG - Intergenic
979013098 4:115396199-115396221 CTGCAGAGGAAGTGGCAGAGAGG + Intergenic
979671717 4:123366607-123366629 CTAGAGCAGCAGCAGCAGAGAGG + Intergenic
980202761 4:129677182-129677204 CTGCTGCAGCCGTGGCTGAAAGG + Intergenic
980282146 4:130736451-130736473 CTGCAGCAGCAGGGGAAGCATGG + Intergenic
981337229 4:143581298-143581320 CTGCAGCTGCAATGGCAGAGAGG - Intronic
981337279 4:143581569-143581591 CTGCAGTGGCAGTGGCAGAGGGG - Intronic
981606468 4:146546105-146546127 CTGCTGTGACAGTGGCAGAGAGG + Intergenic
981915349 4:150026987-150027009 CTGCATCAGCAGTGGCAAAAGGG + Intergenic
982265321 4:153533369-153533391 CTGCAGCAGCAGTGGCGGAGGGG + Intronic
982601583 4:157457942-157457964 CTTCAGCAGAACTGGCAGAGAGG - Intergenic
982615349 4:157633998-157634020 CTGGAGCAGCAGTGGCTATGAGG + Intergenic
982646211 4:158027422-158027444 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
982793712 4:159621231-159621253 CTGCAGCTGCACTGGTAGAAAGG - Intergenic
983628328 4:169825697-169825719 CTGCAGTTGCAATGGGAGAGGGG + Intergenic
983628446 4:169826353-169826375 CTGCAGTGGTAGTGGCAGAGGGG - Intergenic
984465953 4:180100776-180100798 TTGCAGTAGCGGTGGCAGAGTGG + Intergenic
984466003 4:180101024-180101046 CTGCAGTGGTGGTGGCAGAGGGG + Intergenic
984466058 4:180101256-180101278 CTGCGGCTGCAATGGGAGAGGGG + Intergenic
984820518 4:183877660-183877682 CAGCAGCAGCAGCGGAAGTGCGG - Intronic
985741926 5:1622864-1622886 TTGCAGCTGCAGTTCCAGAGAGG - Intergenic
985785128 5:1889363-1889385 CAGCAGCAACAGTGGCTAAGAGG + Intergenic
986903772 5:12468489-12468511 CAGCAGTGGCAGTGGCAGTGTGG - Intergenic
987431927 5:17845194-17845216 CTGGATAGGCAGTGGCAGAGAGG + Intergenic
987441273 5:17960071-17960093 CTGCAGCTGCATTGTCAGATAGG + Intergenic
987518489 5:18947144-18947166 CTGCAGTGGCAGTAGCAGATTGG - Intergenic
987644329 5:20648929-20648951 CTGCAGAGGCAGTGGCAGAGGGG - Intergenic
987795043 5:22616894-22616916 CTTCAGCATGAGAGGCAGAGGGG - Intronic
988348501 5:30070283-30070305 TGTCAGCAGCAGTGGCAGTGTGG - Intergenic
988857477 5:35242838-35242860 CTAGAGCAGAGGTGGCAGAGTGG + Intergenic
988865048 5:35324992-35325014 CAGCAGCAGCAATGGCAGCATGG - Intergenic
988936014 5:36083490-36083512 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
989370325 5:40700368-40700390 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
989461818 5:41708498-41708520 CTGCAGCAACAGTGGCAGAGAGG - Intergenic
989461831 5:41708552-41708574 CTTCAGTGGCAGTGGCAGAGGGG + Intergenic
989716357 5:44468039-44468061 TTGTAACAGCAGTGGCAGTGTGG + Intergenic
989983305 5:50667512-50667534 TTCCAGCAGCGGCGGCAGAGCGG + Intronic
991247598 5:64524771-64524793 CTGAAGCAGGAGAGGGAGAGAGG - Intronic
991565045 5:67996674-67996696 CTGAAGCAGCACAGGCTGAGGGG - Intergenic
992146723 5:73858055-73858077 CAGCAGCAGCAGTAGGAAAGTGG - Intronic
992503346 5:77362985-77363007 CAGCAGCATCAGTGGGAGATGGG - Intronic
992643036 5:78785899-78785921 CTGCAGAAGAAGGGTCAGAGAGG + Intronic
992746352 5:79824858-79824880 CTGCAGGGGCAGAGGCCGAGAGG + Intergenic
993018681 5:82564631-82564653 CTGCAGATACAGTGGCAGAGAGG - Intergenic
993138722 5:84003019-84003041 CTACAACAGCAGTGGCAGAGGGG - Intronic
993225736 5:85165820-85165842 CTGCAACTGCAGTGGTGGAGGGG + Intergenic
993280668 5:85921003-85921025 CTGCCATGGCAGTGGCAGAGGGG - Intergenic
993309676 5:86313775-86313797 CTGCAGCAGCCATGGCTGAAAGG + Intergenic
993351261 5:86853238-86853260 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
993450847 5:88070517-88070539 CTGCAGAAGTAGTGGCAGAGAGG - Intergenic
993634346 5:90326090-90326112 CTGCAGTGGCAATGGCAGAGGGG + Intergenic
994446433 5:99879908-99879930 GTGCAGTTGCAATGGCAGAGGGG - Intergenic
994473414 5:100238433-100238455 CTGCAGAAGCAGTAGCAGAGAGG + Intergenic
994644407 5:102450937-102450959 CTACAGCAGCAAGGGCAGAGGGG + Intronic
994897306 5:105722151-105722173 CTGCAGAGGCAGTGGTAGAGAGG - Intergenic
994970565 5:106731286-106731308 CACCAGCAGCAGTGGCAGCATGG - Intergenic
995187829 5:109290258-109290280 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
995253410 5:110019148-110019170 CTGCAGTGGCAGTGGCAGAGGGG - Intergenic
995271061 5:110220122-110220144 CTGCAGCTGCAATGGTAAAGGGG + Intergenic
997659513 5:135578740-135578762 CAGCAGCAGCAGGAGCAGCGCGG + Exonic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
998043758 5:138970135-138970157 TTGCAGAAGCAGAGGCAGAGAGG + Intronic
998227405 5:140337596-140337618 CACAACCAGCAGTGGCAGAGGGG + Intronic
998821293 5:146060059-146060081 GTGCATCAGCAGGGGCAGTGAGG + Exonic
999052172 5:148534544-148534566 CTGCAGAAGCAGTGGCAGAGAGG - Intronic
999345013 5:150810179-150810201 ATGCAGCAGCAATGACAGACTGG - Intergenic
999383164 5:151136000-151136022 CTGCAGAAGCAATGGCAGGAAGG + Intronic
999394452 5:151218298-151218320 CTGCAGCAGGACTGGCAGTGGGG - Intronic
999448420 5:151659850-151659872 CTGCAGCAGGAGTGGGAGGGAGG + Intergenic
999542070 5:152584788-152584810 CTGCAGCTGCAGTGGCAGAGGGG + Intergenic
1000031683 5:157407129-157407151 CTGCAGAGGCAGTGACAGAGAGG - Intronic
1000698796 5:164422215-164422237 CTGCAGCAGCAGGGGCACAGGGG + Intergenic
1000907339 5:166978799-166978821 CTGCAGCTGCTGTGGCTGCGGGG - Intergenic
1001295655 5:170496985-170497007 CCTCAGCAGCAGAGGTAGAGAGG + Intronic
1002021192 5:176365477-176365499 CGGCCGCAGCAGTCGCAGCGGGG + Exonic
1002387013 5:178875836-178875858 CTGCTGTGGCAGTGGCATAGGGG + Intronic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1002747341 6:69688-69710 CTGTAGAGGCAGTGGCAGAGGGG - Intergenic
1002783171 6:382489-382511 CTTAAGCAGCCGTTGCAGAGAGG - Intergenic
1003058113 6:2841402-2841424 CTGCAGCTGCAGGGAGAGAGAGG - Intronic
1003097785 6:3156305-3156327 CTGCAGCAGCCGCTGCTGAGGGG + Intronic
1004732208 6:18368677-18368699 CAGCAGCAGCAGCGGCTGCGCGG - Intergenic
1004753131 6:18583916-18583938 TATCAGCAGCAGAGGCAGAGAGG + Intergenic
1005072178 6:21872041-21872063 CTGCAGAAGTTGTGGCAGAAGGG - Intergenic
1006376512 6:33674362-33674384 CTGCAGAGGGAATGGCAGAGAGG - Intronic
1006399388 6:33807734-33807756 ATGCAGCAGCCGAGGCAGAGGGG + Intergenic
1007268075 6:40612215-40612237 CTGCAGCAGTGCTAGCAGAGAGG + Intergenic
1007387226 6:41528157-41528179 CAGCGGCAGCGGTGGCAGCGAGG + Intergenic
1007625339 6:43243496-43243518 CGGCGGCGGCAGCGGCAGAGCGG - Intergenic
1007680287 6:43629051-43629073 CGGCAGCAGCAGCGGCTGCGGGG - Exonic
1008166952 6:48150788-48150810 AATCAGCGGCAGTGGCAGAGGGG - Intergenic
1008173242 6:48234680-48234702 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1008211451 6:48729604-48729626 CTGTAAAGGCAGTGGCAGAGAGG - Intergenic
1008219901 6:48842980-48843002 CTACAGTGGCAGTGGGAGAGGGG + Intergenic
1008219940 6:48843245-48843267 TTGCTGTGGCAGTGGCAGAGGGG + Intergenic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1008835567 6:55823410-55823432 ATGCAGCAGGAGTTGCTGAGTGG - Intronic
1008973897 6:57401943-57401965 CTGCAGAGGCAGTGGCAGGGAGG + Intronic
1009162787 6:60303448-60303470 CTGCAGAGGCAGTGGCAGGGAGG + Intergenic
1009325779 6:62346221-62346243 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1009596695 6:65745559-65745581 CTGAAGAGGCAGTGGCAGAGAGG - Intergenic
1009769553 6:68127247-68127269 CTGCAGAGACAGTGGCAGAGAGG + Intergenic
1010019240 6:71139926-71139948 CTGCAGAGGCAGTGGCAGGGAGG - Intergenic
1010465884 6:76166343-76166365 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
1011063170 6:83294616-83294638 CTGCAGAGGCAGTGGCAGAAGGG - Intronic
1011071778 6:83393020-83393042 CAGCACCAGTAGAGGCAGAGAGG - Intronic
1011133147 6:84072747-84072769 CTGCAGCTGCTGTGGGAGATGGG + Intronic
1011283467 6:85700452-85700474 CTGCAGCAAGGCTGGCAGAGGGG - Intergenic
1011290482 6:85772062-85772084 CAGCAGCAGCAGTGGCAGCACGG + Intergenic
1011375515 6:86682178-86682200 CTGCAGCTGCTGTGGGAGATGGG + Intergenic
1011392346 6:86867815-86867837 AGGCAGAGGCAGTGGCAGAGAGG - Intergenic
1011541202 6:88432125-88432147 CAGTAGGAGCAGAGGCAGAGAGG - Intergenic
1011630104 6:89314988-89315010 TAGCAGCAGCAGTGGCACAGTGG - Intronic
1012196019 6:96342170-96342192 CTGCTCCAGCAGTGGCTGAAAGG - Intergenic
1012228963 6:96737737-96737759 CAGCAGCAGCAGGGCTAGAGGGG + Intergenic
1012252015 6:96990920-96990942 CTGCAGTGGCAGTGGCAGAGGGG + Intronic
1012616424 6:101284132-101284154 CAGCAGAAGCAGTGGCAGAGAGG - Intergenic
1013290879 6:108717693-108717715 CTGCAGCCACAGTGGGAGCGGGG - Intergenic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013437210 6:110122519-110122541 CAGGAGTAGCAGAGGCAGAGAGG - Intronic
1014124389 6:117759905-117759927 CTGCAGATGCAGTGGCAGAGAGG - Intergenic
1014183292 6:118408056-118408078 CTGAAGAGGCAGTGGCAGAGAGG - Intergenic
1014199094 6:118588999-118589021 CAACAGCAGCAGCGGCAGTGAGG - Intronic
1014289302 6:119539843-119539865 CAGGAGGACCAGTGGCAGAGAGG + Intergenic
1015197289 6:130537358-130537380 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1015227080 6:130869922-130869944 CAGCAGCAGCAGTGAGAGTGAGG - Exonic
1015678930 6:135781861-135781883 TGCCAGCAGCAGTGGCAGTGTGG - Intergenic
1016986025 6:149896574-149896596 CAGCAGCAGTATTGGCAGGGCGG - Intronic
1017535986 6:155348772-155348794 CTGCAGTGGCAGTGGCAGAGAGG + Intergenic
1018034139 6:159867087-159867109 CTGCGGCATCAGGGGCAGTGGGG - Intergenic
1018107911 6:160506732-160506754 CTGCAGTGGCAGTGGCAGATGGG + Intergenic
1018107956 6:160507011-160507033 CTGCAGCTGAAATGGCAGAGGGG + Intergenic
1018123501 6:160659626-160659648 CTGCAGCTGAAATGGCAGAGGGG + Intronic
1018146884 6:160900073-160900095 CTGCAGCTGCAATGGCAGAGGGG - Intergenic
1018327728 6:162691841-162691863 CTGAAGCAGCAGTAGCAGCCTGG + Intronic
1018399522 6:163408774-163408796 CTGAAGAAGCAGAGGCTGAGAGG - Intergenic
1018435167 6:163752673-163752695 CAGCAGGAGCAAGGGCAGAGAGG + Intergenic
1018903299 6:168061823-168061845 CTGCCGCAGCTGTTGCAGAGTGG + Exonic
1019286052 7:223668-223690 CTGCAGCTGCAGTCACAGGGAGG + Intronic
1019605145 7:1906399-1906421 ATGCAGCTGCAGTGGCAGCCAGG - Intronic
1019756494 7:2774528-2774550 CGCCTGCAGCAGTGACAGAGAGG + Intronic
1019922978 7:4174548-4174570 GTGCAGCTGCGGAGGCAGAGGGG + Intronic
1020007846 7:4791864-4791886 CTGTAGCAGCAGTGGCACGCCGG - Intronic
1020398404 7:7745239-7745261 CTGTCTCAGGAGTGGCAGAGGGG + Intronic
1020426264 7:8069418-8069440 CTGCAGTGGCAGTGGCAGAGGGG + Intronic
1020513783 7:9090964-9090986 CTACAGCAGCAGTGGCAGAGGGG - Intergenic
1020702336 7:11499046-11499068 CTACAGAGGCAGTGGCAGAGAGG - Intronic
1021308796 7:19065654-19065676 CTGGAGCAGCAGTGGCTCAAAGG + Intronic
1021355685 7:19651197-19651219 CGGCCGCTGCAATGGCAGAGGGG - Intergenic
1021355770 7:19651738-19651760 CTGCAGTGGTACTGGCAGAGGGG - Intergenic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1022907107 7:34868081-34868103 CTGCAGGCACAGTGGGAGAGTGG + Intronic
1023165058 7:37335641-37335663 CTGCAGCAGGAGTGAGCGAGGGG + Intronic
1023325826 7:39054697-39054719 CTGCAGCTGCAGTGGGGGTGGGG + Intronic
1023661700 7:42477417-42477439 CTGAAGCAGTAATGGCAGGGTGG + Intergenic
1023712072 7:43005770-43005792 GAGCAGCAGGTGTGGCAGAGGGG - Intergenic
1023886373 7:44360142-44360164 CTACAGAGGCAGTGGCAGAGAGG + Intergenic
1024165437 7:46724787-46724809 CTGCAGAGGCAGTGGCAGAGAGG - Intronic
1024332581 7:48170928-48170950 GTGCAGGTGCAGTAGCAGAGTGG + Intergenic
1024404793 7:48966099-48966121 ATTCAGCAGCACAGGCAGAGAGG + Intergenic
1024696933 7:51867265-51867287 CTGTAGCTGCAGTGGCTTAGAGG + Intergenic
1024992951 7:55250762-55250784 CTGCAGCAGCCCAGCCAGAGAGG + Intronic
1026347987 7:69491512-69491534 CAGCAGTAGTAGTGGCAGGGTGG - Intergenic
1026853479 7:73738659-73738681 CAGCAGCAGCGGCGGCCGAGGGG - Exonic
1027278863 7:76591060-76591082 CTGCAGCTGCAATGACAGAGGGG - Intergenic
1027350454 7:77306359-77306381 CTGCAGCTGCTGTGGTGGAGTGG + Intronic
1027358574 7:77384676-77384698 CTTCAGCAGGAGTGGCAGGTGGG - Intronic
1027369555 7:77494069-77494091 CTGCTCCAGCCGTGGCAGAAAGG + Intergenic
1027627616 7:80564636-80564658 CTGCAGAGGCAGTGGCAGAGAGG + Intronic
1027779454 7:82503980-82504002 CTGCTGCAGCAGAGGAAGAGAGG - Intergenic
1028077443 7:86533953-86533975 CTGCAGGGGCAGTGGGAGAGGGG + Intergenic
1028077489 7:86534234-86534256 CTGCTGTGGCAGTGGCAGAGGGG + Intergenic
1028176952 7:87671300-87671322 CTGCAGCGGCAGTCTCAGAGAGG + Intronic
1028280348 7:88918143-88918165 CTTCAGCAGCAGTGCCAATGTGG + Intronic
1028347220 7:89798092-89798114 TGCCAGCAGCAGTGGCAGTGTGG + Intergenic
1028746504 7:94333321-94333343 CTGTAGCAGCTGTGTCAGATGGG + Intergenic
1029032997 7:97488440-97488462 CTGCCCCAGCAGTTGCAGGGAGG + Intergenic
1029052183 7:97700652-97700674 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1029439032 7:100577300-100577322 CGGCGGCAGCAGCAGCAGAGCGG - Exonic
1029508614 7:100978593-100978615 CTGAAGAGGCAGTGGCAGTGTGG - Intronic
1030234355 7:107242559-107242581 TTGCAGGGGCAGTGGCAAAGAGG - Intronic
1030809396 7:113956214-113956236 CTGCAGAGACAGTGGCAGAGAGG + Intronic
1031629705 7:124032396-124032418 CAGCAGCAGCAGCAGCGGAGGGG - Exonic
1031702780 7:124945467-124945489 CAGCAGCAACAGTGGCAGTGTGG - Intergenic
1031801635 7:126253801-126253823 CTGTGGTAGCAGTGGCAGACTGG - Intergenic
1032071750 7:128812144-128812166 CAGCAGCACCAGTGCCAGTGAGG + Exonic
1032235697 7:130120211-130120233 CTTCAGCAGCAGTGGTATACTGG + Intronic
1032741506 7:134744057-134744079 CTGCAGCAGCCATGGTCGAGGGG + Intergenic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1033224964 7:139554220-139554242 CTGCTCCAGCTGTGGCTGAGAGG + Intergenic
1033424480 7:141231627-141231649 TTGCAGATGCAGTGGCAGAGAGG - Intronic
1034967507 7:155400318-155400340 CTGCAGCTGGGGTGGCAGGGGGG - Intergenic
1035014066 7:155748769-155748791 CTGCAGCAGCAGCCACAAAGGGG - Intronic
1035047460 7:155978054-155978076 CTGCTGCTGCTGTGTCAGAGTGG + Intergenic
1035116821 7:156531907-156531929 CTGCTGCTGCACTGGCATAGCGG - Intergenic
1035133338 7:156675902-156675924 CTGCAGCTGCAGAGGCTGTGGGG + Intronic
1035266026 7:157690766-157690788 CTCCAGCAGCAGCGGCTGCGCGG + Intronic
1035311613 7:157973160-157973182 CTGGAGCAGCAGTGGGTGGGAGG + Intronic
1037150026 8:15626066-15626088 CAGGAGCAGCAGTGGCAGTGGGG + Intronic
1037388333 8:18366027-18366049 CCTCAGTGGCAGTGGCAGAGTGG - Intergenic
1037388373 8:18366303-18366325 CTGCAGTAGCAGTGGCAGAGAGG - Intergenic
1037793329 8:21967697-21967719 AAACAGCAGCTGTGGCAGAGAGG - Intronic
1037821469 8:22137226-22137248 CAGGTGCAGCAGTGGCAGAGGGG + Intergenic
1037829483 8:22179327-22179349 CTGCAGAAGCAGGGGCCCAGTGG + Intronic
1037893202 8:22635001-22635023 CAGCAGCTGGAGTGGCCGAGGGG + Intronic
1037918509 8:22787598-22787620 CTGCGTAAGCAGTGGCAAAGAGG - Intronic
1038170729 8:25128960-25128982 CTGCTGCAGCAGTGGCAGGGCGG - Intergenic
1038233565 8:25729119-25729141 CTGCAGAGGGAGTGGCACAGAGG + Intergenic
1038714002 8:29975405-29975427 CTGCAGCTGGAGTGTCAGAAAGG - Intergenic
1039796784 8:40922629-40922651 CATCAGCAGCAGTGGGTGAGGGG + Intergenic
1040087850 8:43364599-43364621 CTGCAGAGGCAGTGGCATAGAGG - Intergenic
1040404558 8:47087202-47087224 CTTCAGAGGCAGTGGCAGAGAGG + Intergenic
1040560261 8:48517457-48517479 CTGCAGGTGCAGGGGCAGTGGGG + Intergenic
1040685711 8:49870080-49870102 ATGCAGCAGCAGTGTTTGAGAGG - Intergenic
1041012728 8:53559849-53559871 CTGCTGTGGCAGTGGCAGAGGGG - Intergenic
1042193345 8:66210362-66210384 CTACATCAGCTGGGGCAGAGGGG - Intergenic
1042619924 8:70693881-70693903 CTGCAGAGGCAGTGGCAAAGAGG + Intronic
1042764747 8:72308761-72308783 CAGCAGCAGCAGTGGGGGTGTGG + Intergenic
1042874376 8:73427276-73427298 CGGCAGCAGCAGTGGGAGGAGGG + Intronic
1043229870 8:77788328-77788350 TTGCAGAGGCAGTAGCAGAGAGG + Intergenic
1044162463 8:88936151-88936173 CTGCAGATGCAGTGGCAGAGAGG - Intergenic
1044915926 8:97112688-97112710 CTGCAGCAGCACTGACAGCATGG + Intronic
1044927899 8:97224691-97224713 CTGCAGAAGCAGCGGCAGAGGGG - Intergenic
1045193674 8:99908340-99908362 ATGCTTCATCAGTGGCAGAGAGG + Intergenic
1045675850 8:104607487-104607509 CTGCATCAGCTGTGGCAGAAGGG + Intronic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1046121083 8:109848346-109848368 GTGCACCAGTAGTGGCAGGGTGG + Intergenic
1046255740 8:111694351-111694373 CTGCAGCTGCAATGCCAGAGGGG + Intergenic
1046285868 8:112092361-112092383 CAGCAGTGGCAATGGCAGAGGGG + Intergenic
1046486458 8:114894542-114894564 CTGCTGTGGCAGTGGCAGAGGGG + Intergenic
1046895147 8:119463857-119463879 CTGCAGCAGTATTGGCACAAAGG - Intergenic
1047101040 8:121676046-121676068 CTGCACCAACAGTGGCTCAGAGG + Intergenic
1047548086 8:125839225-125839247 CTGCAGTGTCAGTGGCAGAGAGG - Intergenic
1048333786 8:133488848-133488870 CTGCAGCGGCACTGGCAGACAGG + Intronic
1048449580 8:134522008-134522030 CTGCGGAAGCACTGGCATAGAGG - Intronic
1048518626 8:135133629-135133651 GTGCAGCAGCATTTGCAGTGGGG + Intergenic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1049119217 8:140719334-140719356 CTGCAGCAGCCTTGACAGACAGG + Intronic
1049137990 8:140922963-140922985 ATGCAGTCGCAGTGACAGAGAGG + Intronic
1049266045 8:141668451-141668473 CTGGGGCAGGAGTGGCAGGGAGG + Intergenic
1049331475 8:142056362-142056384 CGGCATGAGCAGAGGCAGAGAGG + Intergenic
1049409027 8:142464242-142464264 CAGCAGCAGCAGTAGCAGCGGGG - Exonic
1050261817 9:3848997-3849019 GTGCAGCAGCAGTGGGAAGGGGG - Intronic
1050878726 9:10674089-10674111 CTGCAGCAACAATGACAGAGGGG + Intergenic
1051070986 9:13166757-13166779 CTGCTGAATCAGTGGGAGAGGGG + Intronic
1051726118 9:20089410-20089432 CTGCAATTGCAGTGGCACAGGGG - Intergenic
1051822249 9:21181591-21181613 CTGCAGAGGCAGTGGTAGACAGG - Intergenic
1051827281 9:21234247-21234269 CTGCAGAGGCAGTGGTAGACAGG - Intronic
1051899717 9:22025397-22025419 TTGCAGAGGTAGTGGCAGAGAGG + Intronic
1051946203 9:22572879-22572901 CTGCTGCAGCTGTGGCTGAAAGG + Intergenic
1052311609 9:27074722-27074744 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1052378195 9:27741551-27741573 CTGCAGAGGCAGTGGCCAAGAGG + Intergenic
1052626476 9:30982172-30982194 CTGCAGAGGCAGTAACAGAGAGG - Intergenic
1052703029 9:31960499-31960521 CTGCAGAGGCAGTGGCAAAGAGG - Intergenic
1052836033 9:33250743-33250765 CTACAGCTTCAGTGCCAGAGGGG - Intronic
1053115356 9:35496491-35496513 CTTCAGCAGGAGGGGCAGATGGG - Intronic
1053129607 9:35607559-35607581 CTGCAGGGGCAGGGGCAGAGTGG - Intronic
1053530898 9:38879681-38879703 CAGCAGTGGCAGTGGCAGTGTGG - Intergenic
1053542847 9:38993161-38993183 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1053807293 9:41816678-41816700 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1054203121 9:62104114-62104136 CAGCAGTGGCAGTGGCAGTGTGG - Intergenic
1054623299 9:67370749-67370771 CAGCAGCAGCAGTGGCAGCGAGG - Intergenic
1054635242 9:67484251-67484273 CAGCAGTGGCAGTGGCAGTGTGG + Intergenic
1055023534 9:71695181-71695203 CAGCATCAGCAAAGGCAGAGTGG - Intronic
1055208683 9:73763149-73763171 CTGCAGAGGCAGTGGCAGACAGG - Intergenic
1055336841 9:75240273-75240295 CAGTTGCAGCAGTGGAAGAGTGG + Intergenic
1055373409 9:75624436-75624458 CTGCTGTGGCAGTGGCAGAGGGG + Intergenic
1055647647 9:78376173-78376195 CTGCTGCCTCAGTGACAGAGTGG - Intergenic
1055834152 9:80419221-80419243 CTGCAACTGCAGTGGCAGAAGGG + Intergenic
1056127865 9:83554687-83554709 CTGCAGAAGCAGTGGAAGAGAGG + Intergenic
1056237109 9:84605746-84605768 CTCCAGCAGTGGTGGCAAAGCGG - Intergenic
1057061529 9:92008146-92008168 CTGCAGTAGCAGTTTCAGAGAGG + Intergenic
1057176566 9:93004563-93004585 CAGAAGCAGCAGTGGGACAGAGG - Intronic
1058772934 9:108256251-108256273 CTCCAGCCTCAGTGACAGAGTGG - Intergenic
1059779134 9:117508110-117508132 CTGCAGCTGCAATGGGAGAGGGG + Intergenic
1059891683 9:118811475-118811497 GTGCAGCAGGAGTGAAAGAGTGG - Intergenic
1060224744 9:121783975-121783997 TTCCAGCTGCAGGGGCAGAGGGG - Exonic
1060552221 9:124491054-124491076 GTGCAGCTCCAGTGACAGAGAGG - Intronic
1060834660 9:126745997-126746019 CTGCAGTGGCAGTGGGAGGGTGG + Intergenic
1060975711 9:127763932-127763954 GTCCAGCAGCAGTGGGAGTGAGG + Intronic
1061200493 9:129135704-129135726 CTGCAGCAGCACTGCTAGACTGG - Intronic
1061613496 9:131763849-131763871 AGGAAGCAGCAGTGGCTGAGGGG - Intergenic
1061974470 9:134061403-134061425 CTGGAGGAGCAGTGGCAGGGAGG + Intronic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062186714 9:135222209-135222231 CACCAGCAGGGGTGGCAGAGGGG + Intergenic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1062541639 9:137044219-137044241 CAGCAGCCGCAGTGGCAGGTGGG + Intronic
1203527905 Un_GL000213v1:106585-106607 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1187023290 X:15406785-15406807 CAGCAGCAGAAGGGACAGAGCGG - Intronic
1188707882 X:33357715-33357737 CAGCAGCAGCAGTAGCAGTATGG - Intergenic
1188715013 X:33449618-33449640 CTGTAGAGGCAGTGGCAGAGAGG - Intergenic
1188791757 X:34414190-34414212 CAGCAGAGGCAGTGGCAGAGGGG - Intergenic
1188833908 X:34933164-34933186 CAGCAGCAGTGGTGGCAGTGAGG - Intergenic
1188842887 X:35037526-35037548 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1188869694 X:35359045-35359067 CTGCAGAGGCAGTGGTAGAGAGG + Intergenic
1189104316 X:38220748-38220770 CGGCAGCAGCAGCAGCAGCGCGG + Exonic
1189582051 X:42416378-42416400 CTGCAACAGCAGCGTCAGATGGG - Intergenic
1189583665 X:42434908-42434930 TTGCACCAGCAGTGGCAGCATGG - Intergenic
1190106811 X:47566969-47566991 CGGCAGCTGCAGTTGCAGAGAGG - Exonic
1190635042 X:52425017-52425039 CTGCAGCAGCAGTAACAGCAAGG + Intergenic
1190981484 X:55460041-55460063 CTGAAGTAGCAGTGGCACACAGG - Intergenic
1190987214 X:55513139-55513161 CTGAAGTAGCAGTGGCACACAGG + Intergenic
1191094611 X:56661270-56661292 CTGCAGAGGTGGTGGCAGAGAGG + Intergenic
1191122991 X:56925609-56925631 CTGCAGAGGCAGTGGCAGAAGGG + Intergenic
1191128186 X:56980618-56980640 GGGCAGCAGCAGTAGCAGCGTGG + Intronic
1191155248 X:57266509-57266531 CTGCAAAGGCAGTGGCAGAGAGG - Intergenic
1191156857 X:57283519-57283541 CTGCAATGGCAGTGGCAGAGGGG + Intergenic
1191223667 X:58017162-58017184 TTGCTGTGGCAGTGGCAGAGGGG - Intergenic
1191223704 X:58017442-58017464 CTGAAGAGGCAGTGGCAAAGGGG - Intergenic
1191224710 X:58031144-58031166 CTGCTGTGGCAGTGGCAGAGGGG + Intergenic
1191695552 X:63986079-63986101 TAGCAGCAGCAGTGGCAGTGTGG - Intergenic
1191743699 X:64463701-64463723 CTGCAGAGGCAGTAGCAGAGAGG + Intergenic
1191922503 X:66271410-66271432 CTGCAGAGGCAGTGGCAGAAAGG - Intergenic
1191988871 X:67010523-67010545 CTGCCGAGGTAGTGGCAGAGAGG - Intergenic
1192055537 X:67769488-67769510 CTGCAACTGCAGTGGTGGAGTGG - Intergenic
1192207705 X:69107192-69107214 CTGCTGCAGCAGTGGCTGGCCGG - Intergenic
1192254335 X:69443018-69443040 CTGGAAAGGCAGTGGCAGAGAGG + Intergenic
1192310879 X:70013196-70013218 CTGCAGCTGCAATGGGAGAGGGG - Intronic
1192310935 X:70013471-70013493 CTGCAGTGGCAGTGGCAGAGGGG - Intronic
1192310984 X:70013751-70013773 ATGCAGTGGCAGTGGCAGAAGGG - Intronic
1192691803 X:73372853-73372875 CTGTAGCTGCAATGGCAGATGGG + Intergenic
1192756264 X:74049558-74049580 CTGTAGCTGCAATGGTAGAGGGG - Intergenic
1192756318 X:74049837-74049859 CTGCTGTGGCAGTAGCAGAGGGG - Intergenic
1192858615 X:75040748-75040770 CTGCAGCAGCAGGGGCCATGTGG - Intergenic
1193005960 X:76618284-76618306 TTGCAGAGGCAGTGACAGAGAGG - Intergenic
1193028746 X:76875031-76875053 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1193061707 X:77214422-77214444 TTGCAGATGAAGTGGCAGAGAGG + Intergenic
1193276117 X:79590136-79590158 TGCCAGCAGCAGTGGCACAGTGG + Intergenic
1193295738 X:79829586-79829608 CTGCAGAGGCAGTTGCAGGGAGG + Intergenic
1193317042 X:80076706-80076728 CTGCAGTGGCAGTGGGATAGAGG + Intergenic
1193317083 X:80076985-80077007 CTGCTGTAGCAGTGGCAGAGGGG + Intergenic
1193317136 X:80077263-80077285 CTGCAGCTGCAATGGCAGGGAGG + Intergenic
1193360888 X:80577085-80577107 CTGCTGTGACAGTGGCAGAGGGG + Intergenic
1193408846 X:81139628-81139650 CTGCTGGGGTAGTGGCAGAGGGG - Intronic
1193440541 X:81535495-81535517 CTGCAGCATCAGTGACAGAGGGG + Intergenic
1193467985 X:81869694-81869716 CAAAAGCAGCAGTGGCAGTGAGG - Intergenic
1193496396 X:82219053-82219075 CTGCAGAGGCAGTGGCAGATGGG + Intergenic
1193569792 X:83128116-83128138 CTGCAGCTGCATTGGTAGAGGGG - Intergenic
1193569837 X:83128394-83128416 CTGCCTTGGCAGTGGCAGAGGGG - Intergenic
1193607213 X:83583505-83583527 CCGCTGTAGCAGTGGCAGTGGGG - Intergenic
1193642538 X:84028868-84028890 CTGCAGTGGCAGTGGCAGTGAGG + Intergenic
1193714909 X:84926817-84926839 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1193736214 X:85159838-85159860 CAGCAGCAGCAGTGGCAGCATGG - Intergenic
1193773827 X:85619810-85619832 CTGCGGCTGCAATGGCAGAGGGG - Intergenic
1193773872 X:85620088-85620110 CTGCAGTGGTAGTGTCAGAGGGG - Intergenic
1193779648 X:85686233-85686255 CTGCAGCTGCTGTGGGAGATGGG + Intergenic
1193789124 X:85797308-85797330 CTGCAGAGGCAGTAACAGAGAGG + Intergenic
1193805208 X:85985982-85986004 CTGCAGAGGCAGTGGCAGAGAGG - Intronic
1193858942 X:86640262-86640284 CAGCAGAGGCAGTGGCAGAGAGG - Intronic
1193894684 X:87098673-87098695 CAGCAGCAGCAGTGGCAGTATGG + Intergenic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1193937620 X:87641860-87641882 CTGCAGCTGCTGTGGGAGATTGG - Intronic
1193985599 X:88237410-88237432 ATTCAGAGGCAGTGGCAGAGAGG + Intergenic
1194040689 X:88938576-88938598 CTGCATTGGTAGTGGCAGAGGGG + Intergenic
1194055596 X:89127824-89127846 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1194195055 X:90882614-90882636 CTGCAGTGGCAGTGGCAGAGTGG + Intergenic
1194195146 X:90883165-90883187 CTGCAGCTACAATGGCAGAGGGG + Intergenic
1194201550 X:90958341-90958363 CTGCAGCTGCAATGGTGGAGGGG - Intergenic
1194201600 X:90958619-90958641 CTGCTGTGGCAGTGGCAGAGGGG - Intergenic
1194217410 X:91148060-91148082 CAGCAGCGGCAGTGGCAGCATGG + Intergenic
1194234966 X:91372139-91372161 CTGCTGTTGCAGTGGCAGAGGGG - Intergenic
1194235012 X:91372417-91372439 CTGCAGTGGCAGTGGGAAAGGGG - Intergenic
1194366434 X:93019408-93019430 CAGTGGCAGCAGTGGAAGAGGGG - Intergenic
1194427710 X:93760414-93760436 CAGTAGCAACAGAGGCAGAGCGG + Intergenic
1194838910 X:98714929-98714951 CTGCAGAGGCAGTGGCAAAGAGG + Intergenic
1194838954 X:98715210-98715232 TTGCTGTAGCAATGGCAGAGGGG + Intergenic
1194917528 X:99723408-99723430 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
1194948065 X:100091928-100091950 CTGCAGAGGAAGTGGCAGAGAGG - Intergenic
1195148855 X:102044762-102044784 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1195208132 X:102624748-102624770 CTGCAGAGGCAGTGGCAGAGGGG + Intergenic
1195208178 X:102625029-102625051 CTACTGTGGCAGTGGCAGAGGGG + Intergenic
1195208233 X:102625309-102625331 CTGCAGCTGCAGTGGTGGAAGGG + Intergenic
1195241752 X:102959714-102959736 CTGCAGTGGCAGTGGTAAAGGGG + Intergenic
1195361167 X:104085018-104085040 CTGCCAAAGCAGAGGCAGAGAGG + Intergenic
1195372231 X:104188156-104188178 CAGCAGCAGCAGTGCCAGCATGG + Exonic
1195544476 X:106100009-106100031 CTGCAGCAGCATTGGCAGCATGG + Intergenic
1195544491 X:106100104-106100126 CAGCAGCAGCAGTGGCAGTATGG + Intergenic
1195856505 X:109338199-109338221 CTGCAGAGACAGTGGCAGAGGGG + Intergenic
1195856555 X:109338482-109338504 TTGCTGTGGCAGTGGCAGAGGGG + Intergenic
1196227933 X:113188618-113188640 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1196234258 X:113261143-113261165 TTGCAGTGGCAGTGGCAGAGGGG + Intergenic
1196234311 X:113261422-113261444 CTGCTGTGGCAGTGGCAGAAGGG + Intergenic
1196245191 X:113391740-113391762 CTGCAGCTGCAATGGCAGAGGGG + Intergenic
1196496435 X:116329298-116329320 CCGCAGTTGCAGTGGCAGATGGG - Intergenic
1196515486 X:116606050-116606072 TTGCAGTGGCAGTGGTAGAGGGG + Intergenic
1196528860 X:116759652-116759674 CTGCACAGGCAGTGGCAGAGAGG - Intergenic
1196846943 X:119903973-119903995 CTGCAGCCTCGGTGACAGAGTGG - Intronic
1197076952 X:122364211-122364233 CTGCAGAGGCAGTGACAGAGAGG + Intergenic
1197570759 X:128147607-128147629 CAGCAGCAGCAGTGACAGCCTGG - Intergenic
1197904687 X:131412418-131412440 CTGCTGTGGCAGTGGCAGAGGGG - Intergenic
1197904742 X:131412817-131412839 CTGCAGAGGCAGTGGCAGAGAGG - Intergenic
1197913883 X:131514135-131514157 CCGCAGCTGCAATGGCAGAGGGG + Intergenic
1197988991 X:132296835-132296857 CTGAAGGATCAGTGGCAGATAGG - Intergenic
1198086890 X:133290461-133290483 CTGCAGCCTGAGTGACAGAGCGG - Intergenic
1198312953 X:135438105-135438127 GTGCTGCAGCAGTGGCAGGAGGG + Intergenic
1198797280 X:140410610-140410632 CTGCAGCTGCTGTGGGAGATGGG + Intergenic
1198837842 X:140823530-140823552 CAGCAGATGCAGTGGCACAGAGG + Intergenic
1198975023 X:142327049-142327071 GAGCAGCAGCAGTGGCAGCATGG + Intergenic
1199249037 X:145638215-145638237 CTGCAGAGGCAGTGGCAGAGGGG - Intergenic
1199258428 X:145744009-145744031 CCCCAGCAGCAGTGGCAGCATGG + Intergenic
1199307007 X:146279054-146279076 CTGCAGAGGCAGTGGCAGAGAGG + Intergenic
1199320587 X:146433535-146433557 CTTCACCAGCAGAGGCAGAGTGG - Intergenic
1200056695 X:153465339-153465361 TGGCTGCAGCAGAGGCAGAGAGG + Intronic
1200102646 X:153695582-153695604 CAGAAGCAGCAGTGGCAGCTTGG + Exonic
1200114009 X:153761969-153761991 GTGGTGCAGCAGTGGCAGTGGGG + Intergenic
1200360736 X:155603944-155603966 CTGCAATGGCAGTGGCAGAGGGG - Intronic
1200547391 Y:4533796-4533818 CTGCAGCTGCAATGGTGGAGGGG - Intergenic
1200547440 Y:4534074-4534096 CTGCTGTGGCAGTGGCAGAGGGG - Intergenic
1200553924 Y:4611852-4611874 CAGCAGCGGCAGTGGCAGCATGG + Intergenic
1200674661 Y:6135670-6135692 CAGTGGCAGCAGTGGAAGAGGGG - Intergenic
1201229125 Y:11845973-11845995 CAGAAGCAGCAGTGGCAGTATGG - Intergenic
1201300196 Y:12498566-12498588 CAGCAGCAGGAGCGGCAGGGAGG - Intergenic
1201800702 Y:17952029-17952051 CTCCAGCATGAGTGACAGAGTGG + Intergenic
1202360477 Y:24104547-24104569 CTCCAGCATGAGTGACAGAGTGG + Intergenic
1202510301 Y:25565571-25565593 CTCCAGCATGAGTGACAGAGTGG - Intergenic