ID: 915816595 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:158973658-158973680 |
| Sequence | GCGATGACTGTGCTCCTGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 145 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 10, 4: 134} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 915816595_915816599 | 10 | Left | 915816595 | 1:158973658-158973680 | CCACCCAGGAGCACAGTCATCGC | 0: 1 1: 0 2: 0 3: 10 4: 134 |
||
| Right | 915816599 | 1:158973691-158973713 | TAGAATCACCTCACCAACTGTGG | 0: 1 1: 0 2: 1 3: 6 4: 68 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 915816595 | Original CRISPR | GCGATGACTGTGCTCCTGGG TGG (reversed) | Exonic | ||