ID: 915816595

View in Genome Browser
Species Human (GRCh38)
Location 1:158973658-158973680
Sequence GCGATGACTGTGCTCCTGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915816595_915816599 10 Left 915816595 1:158973658-158973680 CCACCCAGGAGCACAGTCATCGC 0: 1
1: 0
2: 0
3: 10
4: 134
Right 915816599 1:158973691-158973713 TAGAATCACCTCACCAACTGTGG 0: 1
1: 0
2: 1
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915816595 Original CRISPR GCGATGACTGTGCTCCTGGG TGG (reversed) Exonic