ID: 915819394

View in Genome Browser
Species Human (GRCh38)
Location 1:159005873-159005895
Sequence GAGAGCAACCAGATGGCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915819392_915819394 5 Left 915819392 1:159005845-159005867 CCATTTAAGCAGGAAGTAAATAG 0: 1
1: 0
2: 4
3: 18
4: 380
Right 915819394 1:159005873-159005895 GAGAGCAACCAGATGGCCTAAGG 0: 1
1: 0
2: 0
3: 6
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915819394 Original CRISPR GAGAGCAACCAGATGGCCTA AGG Intronic
901101815 1:6725008-6725030 GAGGGCAACCACATAGCCTTGGG - Intergenic
901815177 1:11789681-11789703 AAGAGCAGCCTGATGGCCAAGGG - Exonic
902632383 1:17712829-17712851 GAGAGCAGCCAGAAGACCTAAGG - Intergenic
906635751 1:47409400-47409422 GAGAGCACTGAGATTGCCTAGGG + Intergenic
907783382 1:57587988-57588010 GAGAGCAACAAAGTGGCCTCAGG - Intronic
911613154 1:99979244-99979266 CAGAGCAACCAGATGGAGTGAGG - Intronic
913073285 1:115320013-115320035 GGGAGAATCCAGATGGCCCAGGG + Intronic
915257376 1:154644620-154644642 GAGAACATCTAGATGACCTAGGG - Intergenic
915819394 1:159005873-159005895 GAGAGCAACCAGATGGCCTAAGG + Intronic
922213596 1:223503392-223503414 GAGAGACACCAGCTGGCCCAGGG + Intergenic
922817071 1:228457432-228457454 GAGAGCCACCACAAGGCCAAGGG - Exonic
1065252568 10:23831332-23831354 AAGAGTAAAAAGATGGCCTATGG + Intronic
1073459344 10:103657606-103657628 GTGATCAACCAGTGGGCCTAGGG - Intronic
1075685817 10:124364536-124364558 GTGAGGAACCAGATGGCCTCAGG + Intergenic
1083622867 11:64057572-64057594 GTGACCAGCCAGATGGCCTCAGG - Intronic
1091360909 11:134977923-134977945 GAGAGATGCCAGATGGCCTGGGG - Intergenic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1097682868 12:62665486-62665508 GAGACTAAAAAGATGGCCTAAGG - Intronic
1098537285 12:71607301-71607323 GAGAGCATTCTGATGGCATATGG + Intergenic
1101737287 12:107472501-107472523 GAGGCCAACCAAATTGCCTAAGG - Intronic
1104545137 12:129704324-129704346 GGGAGCACCCACATGGCCCATGG - Intronic
1109240543 13:59881990-59882012 AAGGGCAACCATTTGGCCTAGGG - Intronic
1110758363 13:79202297-79202319 GAGAGCAACCAGAGGAATTAAGG - Intergenic
1112700117 13:101998219-101998241 GAGAGTAAGCAGAAGTCCTATGG - Intronic
1113542587 13:111120857-111120879 GAGTGCAGCCAGATGACCTGGGG - Intronic
1118933273 14:70263007-70263029 GAGAACCACCAGATGGATTAAGG + Intergenic
1118984606 14:70742663-70742685 GAGAGCTCCCAGAGGGCTTATGG + Intronic
1119172567 14:72546102-72546124 GACAGCAACAAGCTGGCCCAGGG - Intronic
1119565620 14:75626731-75626753 TAGTGAAACCAGATGGCCTTTGG + Intronic
1120999779 14:90443348-90443370 GAGAACAGCCAGGTGGCCTGTGG + Intergenic
1121211986 14:92214078-92214100 GAGAGCCACCAGCTGACCTGGGG + Intergenic
1122061538 14:99139541-99139563 GGGAGCATCCTGAAGGCCTAGGG + Intergenic
1124191326 15:27579819-27579841 GAGAACATCCAGAGGGCCAAGGG - Intergenic
1124626472 15:31310328-31310350 GAGAACAGCCCCATGGCCTAGGG + Intergenic
1125051656 15:35305948-35305970 GAAAGGAACCAGCTGGCTTAAGG - Intronic
1125636354 15:41192089-41192111 GAGAACCACCAGGTTGCCTAAGG - Intronic
1126827383 15:52565681-52565703 CTGAGCCACCACATGGCCTAGGG + Intronic
1130028131 15:80287176-80287198 GGGAGCACCCATATGTCCTAGGG + Intergenic
1130172097 15:81525391-81525413 TAGAGAAATGAGATGGCCTAAGG - Intergenic
1131471797 15:92704108-92704130 GAGAGTAAGCAGCTTGCCTAAGG - Intronic
1132160724 15:99539203-99539225 GAGAGCAGCTAGATGGCCCAGGG + Intergenic
1145178537 17:20723462-20723484 AGGAGCAACCAGATGACCCAGGG + Intergenic
1147583438 17:41639202-41639224 GAGGGCAACCTGAGGGCCTGGGG + Intergenic
1148211404 17:45810955-45810977 GGGAGCAGCCAGGTGGCCCAAGG - Intronic
1149374436 17:56030241-56030263 GACAGAGACCAGATGGCCCATGG + Intergenic
1155493316 18:26420476-26420498 AAGAGCAAACACAGGGCCTACGG + Intergenic
1157006176 18:43587738-43587760 GATAGCCACCAGGTGGCATACGG - Intergenic
1157228453 18:45890246-45890268 GAGAGCACACAGAAGGGCTACGG - Intronic
1158670348 18:59468578-59468600 GGGAGCAACCAGAGGACCTACGG + Intronic
1159428865 18:68325131-68325153 GGGAGAAAACAGATGGGCTAGGG + Intergenic
1159899655 18:74034087-74034109 CCGAGCAACCAGATGGCCACAGG + Intergenic
1160603559 18:80032901-80032923 GGGAACAATCAGATGGGCTAGGG - Intronic
1163029483 19:14534922-14534944 GAGAGCCACCAGCTGTCCTAGGG - Intronic
1165707616 19:37987671-37987693 GTGAGTGACCAGCTGGCCTAGGG - Intronic
1165752074 19:38266248-38266270 GGCTGCAGCCAGATGGCCTAGGG + Intronic
1165967989 19:39600578-39600600 GAGAGTAAACAGACAGCCTAAGG + Intergenic
1168402154 19:56091640-56091662 TAGAGAAGCCAGATCGCCTACGG - Intronic
927501463 2:23586035-23586057 GAGAGCACACAGAAGGCCTCTGG + Intronic
927970207 2:27301113-27301135 GAGGGCAACCAGCAGCCCTAGGG - Intronic
929631308 2:43465681-43465703 GAGATCACCCAGAGGGGCTAGGG - Intronic
929868962 2:45741849-45741871 GAGAGCTACCAGAAGGCCATGGG + Intronic
930601865 2:53453058-53453080 GAGAGCAGCAGGATGGCCTCGGG + Intergenic
935447304 2:103170173-103170195 GAGGGCAAACAGCTTGCCTAAGG + Intergenic
941377991 2:164754439-164754461 GAGAGAATCCAGCTGCCCTATGG + Intronic
942688605 2:178561235-178561257 GAGAACTACCAGATGGCCGGTGG - Exonic
942750961 2:179286959-179286981 GAGAGAAACTGGATGGCCCAGGG - Intergenic
945662522 2:212704084-212704106 GAGTACTACCAGTTGGCCTAGGG - Intergenic
947392522 2:229653799-229653821 TAGGGTAATCAGATGGCCTAAGG - Intronic
948357629 2:237392620-237392642 GTGGGCAACCACATGGCATAGGG - Intronic
1170349018 20:15419173-15419195 GAGAGCAACCCCGTGGCCTTGGG - Intronic
1171199851 20:23232124-23232146 GAGAGTGACCAGATTTCCTAGGG + Intergenic
1179464583 21:41563095-41563117 GAGAGAAACAAGATGGCGCAGGG + Intergenic
1183373895 22:37450997-37451019 GAGAGCAGCCAGATGGGGTGAGG + Intergenic
950631161 3:14283141-14283163 GAGAGCAACCGGTTTGCCCAAGG + Intergenic
952546458 3:34425020-34425042 GAGAGGATTCAGATGCCCTAGGG + Intergenic
954672129 3:52296854-52296876 GTGAGCAACCTGCTGGCCTCTGG + Intergenic
958194292 3:90222630-90222652 GAGATCTACAAGATGGCATATGG + Intergenic
959610849 3:108293260-108293282 GAGAGCATCTAGAAGGCCTCAGG + Intergenic
962658879 3:137580493-137580515 GGGAGCAAACAGACAGCCTATGG - Intergenic
964455390 3:156860051-156860073 GAAAGAAGGCAGATGGCCTAGGG - Intronic
967022077 3:185531596-185531618 GTGAGCCACCAGCTGGCCTTAGG - Intronic
968235115 3:197026821-197026843 GACACCTACCAGATGGCCTGGGG + Intronic
968281443 3:197479877-197479899 GACAGCAGCCAGGTCGCCTAGGG - Intergenic
972510121 4:39761152-39761174 GAGGACCACCAGATTGCCTAAGG + Intronic
976457271 4:85262692-85262714 GAGAGCATGCAGATGACTTAGGG - Intergenic
981124618 4:141091672-141091694 TAGACCAACTAGATGACCTAAGG + Intronic
982359326 4:154502340-154502362 GAGAGCAGCGAGATGACATACGG + Intergenic
982581508 4:157185553-157185575 GATATGAACCAGATGGCCCATGG + Intergenic
986277733 5:6294260-6294282 CAGAGTAAACAGATGACCTATGG - Intergenic
988656497 5:33217617-33217639 AAGAAGAACCAGATGGCATAAGG + Intergenic
990722119 5:58708344-58708366 GAGAGCAGGCAGATGGGCAAGGG - Intronic
993528842 5:89000793-89000815 GAGATCAAACTGATGGCCTGTGG + Intergenic
994885611 5:105557621-105557643 CAGAGCAACCAGAGTGCCTGGGG + Intergenic
999122689 5:149221255-149221277 GAGAGCAACCATATGCCACAAGG + Intronic
999546973 5:152640297-152640319 GAGATCAAGCAGAGTGCCTATGG - Intergenic
1000698244 5:164416375-164416397 CAGAGCAAACAGATAACCTATGG - Intergenic
1000789447 5:165587269-165587291 GAGAGGAGCCAATTGGCCTAAGG - Intergenic
1001700031 5:173700183-173700205 GAGACCAACCAGCTTGCCTGAGG + Intergenic
1005476970 6:26217338-26217360 GAGAGCCACCATAAGGCCAAGGG + Exonic
1005645859 6:27837954-27837976 GAGAGCCACCACAAGGCCAAGGG - Exonic
1006088714 6:31615426-31615448 GAGGGCAGTCAGCTGGCCTAGGG + Intronic
1007145837 6:39629763-39629785 GAGAAAATCCAGATGGCCTTGGG - Intronic
1007453360 6:41957230-41957252 GAGATTAATCAGATGGCCTTGGG - Intronic
1012648245 6:101716871-101716893 AAGAGGAGCCAGATGGCCTCAGG - Intronic
1016920855 6:149291504-149291526 GAGAACCACCAGGTTGCCTAAGG + Intronic
1017542077 6:155413328-155413350 GAGAGCAAGGAGATGGGCGAGGG + Intronic
1023012687 7:35937898-35937920 GTGAGCAACAAGATGTCCTAAGG - Intergenic
1024078442 7:45835948-45835970 ATGAGCAACAAGATGTCCTAAGG + Intergenic
1024270222 7:47636149-47636171 GAGAGCAACTGGGTGGCCCATGG + Intergenic
1026201537 7:68218661-68218683 GCCTGCATCCAGATGGCCTAAGG - Intergenic
1026374664 7:69738486-69738508 GAGAGGGAACAGATGGCCTCAGG - Intronic
1026851554 7:73726937-73726959 GAGAGCTACCAGGTGGGCTGCGG - Intergenic
1027695835 7:81409110-81409132 GAGAGCAAGCAAAGGGACTAAGG + Intergenic
1029270837 7:99375499-99375521 GAGAGCAGCCAGGCCGCCTAGGG + Intronic
1029549030 7:101227024-101227046 GAGAGCAACCAGAGGCCTTCAGG - Intergenic
1034441505 7:151087969-151087991 GGGAGGAAGCAGATGGCCCAGGG - Intronic
1035039037 7:155914171-155914193 GAGAGAAACCACATTGCCAAGGG + Intergenic
1035856324 8:2980258-2980280 GAGAGAAACCAAATGGCCCCGGG + Intronic
1036134948 8:6152339-6152361 GAGGGGACCCAGATGGCTTAGGG + Intergenic
1036455878 8:8906785-8906807 GATAGAAACCAGAGGACCTAAGG + Intergenic
1036577514 8:10041807-10041829 AAAAGCCACCAGATGGCTTAAGG + Intergenic
1046763688 8:118047021-118047043 TAGAGCGACCAGATTTCCTAAGG + Intronic
1048612591 8:136040042-136040064 GAGAGCCACCAACTGGACTAAGG - Intergenic
1057495393 9:95556408-95556430 AAGACCAAGCAGATTGCCTAAGG + Intergenic
1062201639 9:135306009-135306031 GCCAGCATCCAGGTGGCCTAAGG + Intergenic
1186210032 X:7240873-7240895 GGGAGCAACCAGAATGCCTGCGG + Intronic
1187491567 X:19756989-19757011 GAGGGGAACCAGGTGGCCGAGGG + Intronic
1188721451 X:33528177-33528199 GAGGGAAACCTGATGCCCTAAGG - Intergenic
1192442457 X:71184827-71184849 GAGAGCAGACAGATGGTCCAGGG + Intergenic
1192791916 X:74390843-74390865 GGGGGCCACCAGATTGCCTAAGG + Intergenic
1193093975 X:77527341-77527363 GAGAGCAAGGAGAAGGGCTACGG + Intronic
1193895618 X:87111099-87111121 CAGAGCAAACAGATAACCTATGG + Intergenic
1196718478 X:118831972-118831994 GAGAGAACACAGATGGCCTGGGG - Intergenic
1197175078 X:123477011-123477033 GGAAGCCACTAGATGGCCTAAGG + Intronic
1199019992 X:142868173-142868195 GAGAGCATGCAGATGGACTGGGG + Intergenic
1200252125 X:154559347-154559369 GAGAGTAACCAGCAGGCCTGAGG - Intronic
1200265643 X:154645069-154645091 GAGAGTAACCAGCAGGCCTGAGG + Intergenic
1200292007 X:154884421-154884443 GACAGAAAGCAGATGGACTAGGG + Intronic
1200338845 X:155380158-155380180 GACAGAAAGCAGATGGACTAGGG + Intergenic
1200347624 X:155460534-155460556 GACAGAAAGCAGATGGACTAGGG - Intergenic