ID: 915825148

View in Genome Browser
Species Human (GRCh38)
Location 1:159067861-159067883
Sequence ACGTTGTCTGCCACTCCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915825148 Original CRISPR ACGTTGTCTGCCACTCCCTC AGG Intronic
900644636 1:3703351-3703373 CCGATGTCGGCCTCTCCCTCTGG - Intronic
903586299 1:24417871-24417893 ACAATTTCTGCCACTCCCTGAGG - Intronic
905760519 1:40553166-40553188 ACGTAGTCTTCTACTGCCTCTGG + Intergenic
905972179 1:42150582-42150604 ACATTTTCTGCCAATCTCTCTGG - Intergenic
908910952 1:69071971-69071993 ATGCTGGCTGCCCCTCCCTCAGG + Intergenic
912475442 1:109931612-109931634 AAGCTGTCTACCACTCCCTCAGG - Intergenic
915825148 1:159067861-159067883 ACGTTGTCTGCCACTCCCTCAGG + Intronic
919826952 1:201509859-201509881 ACTTTGTCTGCTGCTTCCTCTGG + Intergenic
920386679 1:205574928-205574950 AGTTTGTCTGCCCCTCCCTTTGG + Intronic
922245775 1:223795999-223796021 CTGTTGTCTGGGACTCCCTCAGG + Exonic
923525420 1:234768836-234768858 ACGTTGACTCCCACGCCCTGAGG + Intergenic
1065518907 10:26552798-26552820 ACATCGTCAGCCACTCCCTTTGG + Intronic
1076923325 10:133466889-133466911 CAGATGTCTGCCACTCTCTCTGG - Intergenic
1077269249 11:1667367-1667389 CCGGTGTCTGCCCCTCCATCTGG + Intergenic
1077271296 11:1683338-1683360 CCGGTGTCTGCCCCTCCATCTGG - Intergenic
1080039995 11:27749534-27749556 ACCTCCTCTGCCACTACCTCAGG + Intergenic
1093690397 12:22102697-22102719 AGGTGGCCTGCCCCTCCCTCTGG + Intronic
1094019781 12:25901944-25901966 AAGTTGTCTGCCAATGCCTATGG + Intergenic
1104063005 12:125283788-125283810 GGTCTGTCTGCCACTCCCTCTGG + Intronic
1113226784 13:108168347-108168369 ATGGTGGCCGCCACTCCCTCTGG - Intergenic
1117579962 14:57142498-57142520 ACATTTTGTGCCACTCCCACAGG + Intergenic
1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG + Intronic
1124835551 15:33193546-33193568 AGGTTGTCTGCTACTCCACCTGG + Intronic
1126850740 15:52795482-52795504 CCGTTGCCTTCGACTCCCTCCGG + Intergenic
1132660711 16:1060381-1060403 GCCGTGTCTGCCAGTCCCTCGGG + Intergenic
1132882814 16:2169987-2170009 ACAGTGTCTGCCCCTCCCCCAGG + Intronic
1136615436 16:31395527-31395549 ATGTAGTGTCCCACTCCCTCGGG - Intronic
1137613572 16:49834718-49834740 ACGCTGTGTGCCAGTCCCTGGGG + Intronic
1140775096 16:78242133-78242155 ACTTTGTCTGCTTCTGCCTCGGG + Intronic
1147725435 17:42563845-42563867 ACCCTTTCTGCCACCCCCTCTGG + Intronic
1147906362 17:43825632-43825654 ACTTTGCCTGCCACCTCCTCAGG + Intronic
1159637289 18:70820735-70820757 TCCTTGACTGCAACTCCCTCTGG + Intergenic
1163304396 19:16468733-16468755 ACGGTGTCAGCCACTGCATCTGG - Intronic
1164871160 19:31644714-31644736 ACGTTGCATTCCACTTCCTCAGG - Intergenic
927210694 2:20637378-20637400 ACTCTGGCTGCCTCTCCCTCAGG + Intronic
930129333 2:47833046-47833068 ACTTTGTCTGCCACTTTCCCAGG + Exonic
937449224 2:121987357-121987379 AAGTTGGCTGCAACTCCTTCAGG + Intergenic
939760008 2:146163599-146163621 AGGTTTTCTGCCCCTCCCACTGG + Intergenic
941452494 2:165676644-165676666 ACATTGTCTACCACCCCCTAAGG + Intronic
1170011445 20:11728250-11728272 ATGGTGGCTGCCACTCCCCCAGG - Intergenic
1173148405 20:40545141-40545163 AACTTGTCAGCCTCTCCCTCTGG + Intergenic
1174362300 20:50036610-50036632 TCGATGTCTGTCACTCCCACGGG + Intergenic
1174992172 20:55522917-55522939 ATGGTGGCTGCCCCTCCCTCAGG + Intergenic
1179534359 21:42041877-42041899 AGGATGTCTGCCACACCCCCCGG + Intergenic
1182277686 22:29200869-29200891 ACTTTGTCTCCCTCTCTCTCTGG + Intergenic
1183029866 22:35095522-35095544 ACTGTGTCTGCCACACTCTCTGG + Intergenic
1183253460 22:36745882-36745904 CTGGTGTCTGCCACTCTCTCGGG + Intergenic
1185399736 22:50609631-50609653 ACTCTGCCTGCCTCTCCCTCTGG + Intronic
949832321 3:8228664-8228686 ACATGTTCTGCCACTTCCTCTGG + Intergenic
955688997 3:61572174-61572196 ACCTTGTCTGCTACTCCCTCAGG - Intronic
955720467 3:61874971-61874993 ACGTAGTCTACAACTCCATCAGG + Intronic
960456561 3:117879931-117879953 ACTCTGTCTGTCACTCACTCAGG + Intergenic
961330213 3:126133985-126134007 ACCTTGTCTAACTCTCCCTCTGG + Intronic
965342828 3:167511716-167511738 ATGGTGACTGCCCCTCCCTCTGG - Intronic
968699731 4:2048927-2048949 GCCTTCTCTGCCACTGCCTCAGG + Intergenic
974302390 4:60084848-60084870 ATGTTGGCTGCCAGTCCATCTGG - Intergenic
985922723 5:2992143-2992165 ACGTTGTCTGGCAACCCCGCAGG - Intergenic
989150834 5:38298377-38298399 ACCTTCTCTGCCTCTCCCTAGGG + Intronic
990333374 5:54748850-54748872 AGGCTCTCTGCCACTCTCTCTGG + Intergenic
992620523 5:78587954-78587976 ATGTTCTCTGCCCCTCCCTCCGG + Intronic
993496408 5:88614920-88614942 ACTTTTTCTTCCACTCCCTTCGG - Intergenic
1007609709 6:43141682-43141704 GCGTTGTCTGTCACCCACTCTGG - Exonic
1009596651 6:65745277-65745299 TGGTGGCCTGCCACTCCCTCTGG - Intergenic
1011370649 6:86633654-86633676 TGGTGGTCTGCCCCTCCCTCCGG + Intergenic
1015868872 6:137755549-137755571 TTGCTGTTTGCCACTCCCTCTGG - Intergenic
1018206164 6:161439138-161439160 ACCTTGTCTGCCTTTTCCTCCGG - Intronic
1024214672 7:47238505-47238527 ACCTTGTCTACCTCTCCCACTGG - Intergenic
1024318406 7:48042740-48042762 AAGTTGTCTGCTACTGCCACAGG + Intronic
1026725062 7:72864500-72864522 AGGGTGTCTCCCACTCCTTCAGG + Intergenic
1028177043 7:87671845-87671867 ATGGTGCCTGCCACTCCCCCTGG + Intronic
1029274801 7:99397690-99397712 CCTGTGCCTGCCACTCCCTCGGG - Intronic
1029275739 7:99403295-99403317 ACGTTGTCTGCATCTACCTTTGG + Intronic
1032106742 7:129037966-129037988 CTGTTGTCTGCCATTCTCTCTGG - Intronic
1034453995 7:151154957-151154979 AAGTTGTCCTCCACTCCCTCTGG - Intronic
1034843150 7:154418247-154418269 ACCTTGCCTGCCACTAGCTCTGG + Intronic
1034846461 7:154450941-154450963 TGGTTGTCTGGCACTCCCTTTGG + Intronic
1035533454 8:373467-373489 ATGTTTTCTGCCACACACTCAGG + Intergenic
1035865989 8:3082443-3082465 ACCTTCTCTGCTACTCCCGCCGG + Intronic
1036129134 8:6091799-6091821 CCGCTGTCTGGCACTCCCTAGGG + Intergenic
1036442941 8:8797446-8797468 ATGATCTCTGCCACTCCTTCCGG + Exonic
1042312843 8:67395994-67396016 CCTTTGTGTGCCACTCTCTCTGG + Intergenic
1051428074 9:16954409-16954431 ACCTTTTCTGCCACTCACACTGG - Intergenic
1053178237 9:35945121-35945143 ATGGTGTCTGCCCCTCTCTCAGG - Intergenic
1054961089 9:70970407-70970429 AGGTTGTCAGTCACTCCTTCTGG + Intronic
1056816621 9:89806412-89806434 AAGTCTTCTGCCACTCCCTCTGG - Intergenic
1058514141 9:105752192-105752214 ATGGTGACTGCCCCTCCCTCTGG - Intronic
1059171823 9:112131926-112131948 ACATTCTCCTCCACTCCCTCAGG - Intronic
1061317260 9:129803938-129803960 AGGGTGTCTGCCACACCCTAGGG - Intronic
1062076989 9:134594898-134594920 AGGGTGTCTGCTCCTCCCTCTGG + Intergenic
1186086368 X:5994722-5994744 CAGTTGTCTGCCAATCCCTTAGG - Intronic
1188273391 X:28171652-28171674 ACCTTGTCTGTCTCTGCCTCTGG + Intergenic