ID: 915826651

View in Genome Browser
Species Human (GRCh38)
Location 1:159085223-159085245
Sequence CTTGCAGCCCAGATGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915826651_915826655 19 Left 915826651 1:159085223-159085245 CCTGTGTCCATCTGGGCTGCAAG 0: 1
1: 0
2: 2
3: 13
4: 188
Right 915826655 1:159085265-159085287 GACTCCTGTCTTCTGAGTTGGGG 0: 1
1: 0
2: 1
3: 16
4: 221
915826651_915826653 17 Left 915826651 1:159085223-159085245 CCTGTGTCCATCTGGGCTGCAAG 0: 1
1: 0
2: 2
3: 13
4: 188
Right 915826653 1:159085263-159085285 CTGACTCCTGTCTTCTGAGTTGG 0: 1
1: 0
2: 2
3: 20
4: 247
915826651_915826654 18 Left 915826651 1:159085223-159085245 CCTGTGTCCATCTGGGCTGCAAG 0: 1
1: 0
2: 2
3: 13
4: 188
Right 915826654 1:159085264-159085286 TGACTCCTGTCTTCTGAGTTGGG 0: 1
1: 0
2: 2
3: 19
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915826651 Original CRISPR CTTGCAGCCCAGATGGACAC AGG (reversed) Intronic
900199567 1:1398307-1398329 CTTGGAAGCCAGGTGGACACAGG + Exonic
900226646 1:1536218-1536240 CTTGGAGCAGAGCTGGACACAGG + Intronic
900542923 1:3212967-3212989 CTGGCAGCAGAGCTGGACACAGG + Intronic
903184113 1:21619800-21619822 CTGGGAGCCTAGATGGACTCCGG + Intronic
904457712 1:30657445-30657467 CATGCAGTCCAAATGGACAAGGG - Intergenic
908472592 1:64458845-64458867 ATTGCAGTGCAGATGGACAAAGG + Intergenic
915318656 1:155043940-155043962 GGGGCAGCCCAGCTGGACACTGG - Intronic
915826651 1:159085223-159085245 CTTGCAGCCCAGATGGACACAGG - Intronic
916562389 1:165944248-165944270 CAGGCTGCCCTGATGGACACAGG + Intergenic
916611599 1:166397103-166397125 CTTGCAGCCCAGTAGGCCCCTGG + Intergenic
917352987 1:174097303-174097325 TTTGCAGCTCTGATGGACACTGG + Intergenic
919746088 1:201010095-201010117 CTTGCAGCCCCCATGGGCATTGG - Intronic
922730289 1:227945860-227945882 CCAGCAGCCCAGATGGAACCTGG + Intronic
922778251 1:228227546-228227568 CTAGCAGCCCTCATGGACCCAGG - Intronic
924594575 1:245434382-245434404 CTTGCAGCCCAGCTGGACCCTGG - Intronic
1063425787 10:5949109-5949131 CGTGCAGCACAGCTGGAGACAGG + Intronic
1064223850 10:13465035-13465057 CTTGCAGTCTTGATGAACACTGG - Intronic
1067087181 10:43249147-43249169 CCTGCTCCTCAGATGGACACAGG - Intronic
1067547395 10:47203672-47203694 GTTACAGCCCAGATGTACCCTGG - Intergenic
1069793665 10:71039383-71039405 ATGGCAGCCCAGATGGGCATCGG - Intergenic
1070981746 10:80653981-80654003 CTTCCAGCCTGGATGGACTCGGG - Intergenic
1071984162 10:91034152-91034174 CTCGAAGCCCAGGAGGACACTGG + Intergenic
1072757061 10:98028638-98028660 GGTGCAGCCCAGATGGAGAAGGG + Intronic
1073434567 10:103508451-103508473 CTTCCAGCCCCGAGGGACAAAGG + Intronic
1073693158 10:105834238-105834260 CTTGCAGTTCAGATGAAAACTGG + Intergenic
1074290787 10:112136829-112136851 CTGGCAGCCCAGGTGGCTACTGG + Intergenic
1075687384 10:124373746-124373768 CTTCAAGCCCAGCTGGACCCAGG - Intergenic
1076778592 10:132711466-132711488 CTTGCAGCAGTGATGAACACAGG + Intronic
1079585730 11:22124927-22124949 CTTGCAGGCCAGAAGGAAAAGGG + Intergenic
1082950358 11:58808494-58808516 CCTGTAGCCTAGGTGGACACAGG - Intergenic
1083544357 11:63537887-63537909 CTCACAGCCCAGAGGGGCACAGG + Intronic
1083814113 11:65122390-65122412 CCCGCAGCCCCGCTGGACACCGG - Exonic
1087116411 11:94529639-94529661 CTTGGAAGCCAGATGGACATGGG - Intergenic
1089130212 11:116206452-116206474 AGTTCAGCCCAGGTGGACACAGG - Intergenic
1089188981 11:116640797-116640819 CTTTCAGCCCATATGGGCCCTGG - Intergenic
1089214950 11:116829692-116829714 CCTGCAGCCCAGATGAGCTCAGG - Intronic
1097181261 12:57173321-57173343 CTTGCAGCCAAACTTGACACTGG - Exonic
1097187076 12:57201773-57201795 CTTGCAGCCCAGATGACCTGTGG + Exonic
1100273679 12:93050268-93050290 CTTGCAGCCAAGATTGAAATGGG - Intergenic
1101092386 12:101301099-101301121 CTTGCAGTCCATATAGAAACAGG + Intronic
1102247009 12:111362313-111362335 CCTGCAGCTCAGAGGGTCACTGG - Exonic
1103229214 12:119314026-119314048 TATGCAGCCCAGATAGCCACAGG + Intergenic
1106028148 13:25974621-25974643 ACTGCAGCTCAGATGGACAGGGG - Intronic
1106906837 13:34418522-34418544 CTTGCAGCACAAATGGAGACAGG - Intergenic
1107291766 13:38862742-38862764 CTTGCAGACCATATGAAAACAGG - Intronic
1113433873 13:110273750-110273772 TGTGCAGCACTGATGGACACTGG - Intronic
1117873092 14:60221062-60221084 CTTACAGCCCGGGAGGACACTGG - Intergenic
1118324878 14:64773973-64773995 CTCGCAGCCCATGTGGGCACAGG + Intronic
1118605887 14:67503235-67503257 CTTGCAGCAGAGATGGTCTCTGG + Intronic
1118904029 14:70010534-70010556 CTGGCAGCAGAGATGGCCACAGG + Intronic
1124810708 15:32935289-32935311 CTTGCAGACCAGAAGGATATAGG - Intronic
1127760246 15:62132513-62132535 CTTGCAGGCCATATGAAAACAGG + Intergenic
1129123119 15:73415123-73415145 CCTGGAACCCAGATGGTCACGGG - Intergenic
1132350444 15:101136578-101136600 CTTGCATCTCACATGCACACAGG + Intergenic
1132504738 16:302118-302140 CTTGCAGACCTGGTGGTCACTGG - Intronic
1132560670 16:592106-592128 CCTGAAGCGCAGATGGACTCTGG - Intronic
1133104846 16:3500822-3500844 CTTGCAGCCCTCATAGACGCCGG + Intergenic
1133279694 16:4658179-4658201 GCTGCAGACCAGATGGACGCTGG - Intronic
1136187428 16:28596452-28596474 CCTGGAGCCCAGATGGACTGTGG - Exonic
1136189903 16:28609367-28609389 CCTGGAGCCCAGATGGACTGTGG - Intronic
1136319060 16:29470780-29470802 CCTGGAGCCCAGATGGACTGTGG + Intergenic
1136433631 16:30210124-30210146 CCTGGAGCCCAGATGGACTGTGG + Intergenic
1137768591 16:50996657-50996679 CCTGCAGCCCACCTGGGCACTGG - Intergenic
1138273564 16:55713716-55713738 CTGGCAGGCCAGTTGGAAACTGG + Intergenic
1138639021 16:58368040-58368062 GTTGCAGCTGAGATGGACACTGG - Intronic
1139752081 16:69115051-69115073 ACTGCCACCCAGATGGACACAGG - Exonic
1141032654 16:80603016-80603038 CTTGCAGCCCAGGGGCACAGGGG + Exonic
1141875874 16:86824102-86824124 TTGGCTGCCCAGATGCACACAGG + Intergenic
1143400593 17:6639985-6640007 CTTGCAGCCTCGATGGAGCCTGG + Intronic
1144226504 17:13153580-13153602 CTTGCATCCCAATTGGAAACTGG + Intergenic
1145004573 17:19330110-19330132 CTTCCATCCCAGAGGCACACAGG - Intronic
1145745816 17:27318906-27318928 CTAGCAGCCCAAATGGACTAAGG + Intergenic
1149868757 17:60164870-60164892 CATGCAGCCCAGACTCACACCGG + Intronic
1150227541 17:63532039-63532061 CTTGCAGCTCTGGGGGACACTGG + Intronic
1151455886 17:74225624-74225646 CCTGCAGGCCAGAGGGACACAGG + Intronic
1151820154 17:76492780-76492802 GGTGCAGCCCAGAGGGAAACAGG + Intronic
1154235171 18:12598681-12598703 CATGCAGCCCTGATTGTCACTGG + Intronic
1155872308 18:31043050-31043072 CTGGCAGCCCAGATCGTCCCAGG + Intergenic
1160028566 18:75239129-75239151 TTGGAAGCCCACATGGACACAGG + Intronic
1165790612 19:38489470-38489492 CTCCCAGCCCAGATGGACAGAGG - Intronic
1166395931 19:42441170-42441192 TTTGCAGCCTAGAAGGACAGGGG + Intronic
1167036652 19:46998921-46998943 CTTCCTGACCAGATGGAGACGGG - Intronic
1167854830 19:52229078-52229100 CCTCCAGCCCTGATGGCCACAGG - Exonic
926691249 2:15735539-15735561 CTGGCAGCCAGCATGGACACTGG - Intronic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
933748716 2:85589393-85589415 CCTGGAGCCAAGATGGACCCAGG - Intronic
934051690 2:88216377-88216399 CTTGCAGGCCAGATAAAAACAGG - Intergenic
935701290 2:105814336-105814358 CTTGAATCCCAGATGGCCACTGG + Intronic
936525725 2:113240345-113240367 CCAGCAGCCCAGACGGTCACTGG + Intronic
937066289 2:119020409-119020431 CTAGAATCCCAGATGTACACAGG - Intergenic
937884984 2:126893516-126893538 CTTGCTGCACAAAAGGACACAGG + Intergenic
939228222 2:139390527-139390549 CTTCCAGTCCAGAGGGTCACAGG - Intergenic
942111149 2:172683882-172683904 CCTGCAGCCCAGAGGAAGACTGG + Intergenic
946735700 2:222752288-222752310 ACAGCAGCCCAGATGGACAAAGG + Intergenic
947141483 2:227022965-227022987 CTTTCAGCCCTAATGGACACTGG - Intronic
948630333 2:239298389-239298411 CTTGCACCTCAGAGGGAAACAGG + Intronic
1169448098 20:5688918-5688940 CTTACTGGCCAGATGGCCACGGG + Intergenic
1173419158 20:42885449-42885471 CTTCCAGGCCACATGGACATAGG - Intronic
1175737995 20:61400443-61400465 CTTGCAGCCTAGATGATCCCCGG + Intronic
1175965540 20:62658375-62658397 GTAGCCGCACAGATGGACACTGG - Intronic
1176132519 20:63502340-63502362 CTGGCAGCCCAGAGGCAGACAGG + Intergenic
1178919093 21:36726850-36726872 CTCCCAGCCCAGATGTAGACAGG - Intronic
1179929181 21:44555865-44555887 CTTCCAGGACAGAAGGACACAGG - Intronic
1180048070 21:45318774-45318796 CCTGCAGAGCAGATAGACACAGG - Intergenic
1180892355 22:19298515-19298537 CTTGCATCCAAGATGCAGACTGG - Intergenic
1181054379 22:20253144-20253166 CTTCCAGCCCAGATGCAGCCAGG - Intronic
1181286902 22:21758990-21759012 CATGGGGCCGAGATGGACACAGG - Exonic
1181393421 22:22600386-22600408 CTGACAGCCCAGAAGGACTCCGG + Intergenic
1181499129 22:23305837-23305859 CTTGCAACCCAGGGGGACCCTGG + Intronic
1182142436 22:27972735-27972757 CGTGCAGCCCAGAGTGACAGAGG - Intergenic
1182452511 22:30429745-30429767 CTTGCAGCCCAGGTGCAGTCAGG + Intergenic
1182843904 22:33415138-33415160 CCTGCAGCCCAGCTGCACAAAGG + Intronic
1184469688 22:44689412-44689434 CTTGCCGCCCAGATGCCCAGGGG - Intronic
1185214348 22:49589919-49589941 CTGGCAGTCCAGCGGGACACAGG + Intronic
950118783 3:10468167-10468189 CCCACAGCCCACATGGACACTGG - Intronic
952000986 3:28785475-28785497 ATTGCACCCTTGATGGACACAGG + Intergenic
955036401 3:55272443-55272465 CTAGCAGACCAGTTGGACAAGGG - Intergenic
957615475 3:82520688-82520710 CTTGCAGTCCAGCTGGCCTCAGG - Intergenic
961382032 3:126501343-126501365 CCTGCACCCCAGCTGCACACAGG + Intronic
963287642 3:143450766-143450788 ACTGCAGCCCACATGGACACAGG + Intronic
966880580 3:184347771-184347793 CTTGCAGTCCAGGAGGACAACGG + Intronic
967686628 3:192424531-192424553 CTTGAAGCCAAGATGCACAAGGG - Intronic
967920050 3:194607832-194607854 CTGCCAGCCCAGCTGGACAGTGG + Intronic
968517238 4:1020582-1020604 CTTCCAGCCCAGAGGCACCCAGG + Intronic
968809826 4:2794779-2794801 CTTTCTGCCCACATGGACAGAGG + Intronic
969865643 4:10075474-10075496 CTTTCTTCCCAGATGCACACCGG - Exonic
971231901 4:24806860-24806882 AGTGCAGCCCAGAAGGACCCAGG - Exonic
972355484 4:38276429-38276451 CCTGCATTCAAGATGGACACTGG - Intergenic
972971803 4:44585457-44585479 CTTGCAGGCCAGCTGGGCGCAGG + Intergenic
976382829 4:84419752-84419774 TTGGCATCCCAGATGGAGACAGG + Intergenic
978395507 4:108275312-108275334 CTTGTATCCCAGATAGACAGTGG - Intergenic
979683431 4:123485588-123485610 CTTGATGCCCAGATTGACAGGGG + Intergenic
985575394 5:671325-671347 CTTGGGGCCCAGAGGGACCCCGG + Intronic
986318623 5:6609411-6609433 CTTGCAGCCAAGGTGAACCCGGG + Intronic
986851152 5:11815992-11816014 TCTGCAGCCCAGCTGGCCACGGG - Intronic
989129106 5:38086968-38086990 CTGACACGCCAGATGGACACTGG + Intergenic
990254405 5:53950990-53951012 CTTGCAGGCCATATGAAAACAGG - Intronic
995610112 5:113900519-113900541 CTTGGAGCCCAGTTATACACAGG + Intergenic
997975176 5:138437751-138437773 CTTTCAGCCCAGATGGGCACAGG + Intergenic
1003963585 6:11232277-11232299 CTTTCAGAGCAGATGGACTCGGG + Intronic
1005393614 6:25359068-25359090 TTTTCTGCCAAGATGGACACTGG + Intronic
1006557041 6:34876108-34876130 CTTGCAGCCCAGTTAAAGACAGG - Exonic
1007509805 6:42366211-42366233 CTGGCAGTCCACATGGGCACAGG - Intronic
1008428443 6:51386600-51386622 TTTGCAGCCCACATGGTCTCTGG - Intergenic
1008651364 6:53566620-53566642 CTTGCAACCCAGATCAACACTGG - Intronic
1012959493 6:105607809-105607831 CTGGCAGCCCAGAAGGGGACAGG - Intergenic
1013366988 6:109444106-109444128 CAGGCAGCCCAGATGAACAGGGG + Exonic
1015996060 6:138996201-138996223 CTTGCTTCCGAGATGGATACTGG + Intergenic
1019117736 6:169778907-169778929 CTGGCAGCCCTGATGTAGACCGG + Intronic
1019487379 7:1295674-1295696 CTGGCACCCCCGAGGGACACAGG - Intergenic
1019670318 7:2274499-2274521 TCTGCAGCCCAGGGGGACACAGG + Intronic
1019861226 7:3659790-3659812 CTGGCAGCCCAGATGAAGACAGG + Intronic
1021808777 7:24382281-24382303 CCAGCAGACCAGGTGGACACCGG - Intergenic
1023813441 7:43930012-43930034 CATTCAGCCCAGAGTGACACAGG - Intronic
1023999061 7:45179042-45179064 CCTCCACCCCAGCTGGACACTGG + Intronic
1028640672 7:93039371-93039393 CTTCCAGCCCCCAAGGACACAGG - Intergenic
1029641873 7:101826153-101826175 CTTGAAGCTCAGATGTACAGAGG - Intronic
1031964785 7:128019862-128019884 CTGGCAGCCCAGGTTGACTCAGG - Intronic
1032499972 7:132392914-132392936 CTGGGTGCTCAGATGGACACAGG - Intronic
1033234967 7:139630844-139630866 CTGGCAGTCCAGAGGGAGACAGG - Intronic
1033275920 7:139971560-139971582 TTTGCAGCCCAGATGACCTCTGG - Intronic
1033514070 7:142089111-142089133 CAAGCAGCCCACATGGACACAGG + Intronic
1034489230 7:151384290-151384312 TTTGCTGCCCAGATGGAATCAGG - Intronic
1035162692 7:156962619-156962641 CATGCAGCCAGGATGGAGACTGG + Intronic
1035678123 8:1469122-1469144 CTCACATCCCAGCTGGACACGGG - Intergenic
1035771310 8:2148944-2148966 CGTGCAGCCCCGATGGAGTCAGG - Intronic
1036767154 8:11556384-11556406 CGTGCAGGACAGAAGGACACAGG + Intronic
1040295924 8:46149039-46149061 CTTCCATCCCAGAAGGCCACAGG - Intergenic
1040333798 8:46405924-46405946 CTTTCATCCCAGATGTCCACAGG + Intergenic
1047786851 8:128161785-128161807 CCTGCAGCTCAGCTGGACACAGG - Intergenic
1048723353 8:137354182-137354204 TTTCCAGCCCAAATGGACATGGG + Intergenic
1048842056 8:138575162-138575184 CTAACAGCCCAGATGGAGAGAGG - Intergenic
1048866839 8:138767709-138767731 TTTGCAGCCAGGATGGAGACCGG - Intronic
1049207111 8:141368688-141368710 CAGGCAGCCCAGATGGGCAGAGG + Intergenic
1049705426 8:144040006-144040028 CTTGCAGCCCAGCGCCACACCGG + Exonic
1049804794 8:144533948-144533970 GGTGCAGCCCAGAAGAACACGGG + Intronic
1049844033 8:144791480-144791502 CTTGCAGCCCAGCTCAACATTGG - Exonic
1049932360 9:469721-469743 CTTACAGGCTAGGTGGACACAGG - Intergenic
1052454521 9:28678254-28678276 CTTTCAGCACAGATGGAGCCTGG - Intergenic
1052991221 9:34520412-34520434 CTTGAACCTCAGATGGACATGGG - Intronic
1053594376 9:39545122-39545144 CTTGTTGCCCAAATGGGCACTGG + Intergenic
1053852157 9:42300155-42300177 CTTGTTGCCCAAATGGGCACTGG + Intergenic
1054571880 9:66819845-66819867 CTTGTTGCCCAAATGGGCACTGG - Intergenic
1054931111 9:70636309-70636331 CTTGCAGCCCATACAGAAACAGG + Intronic
1055550075 9:77425243-77425265 CCTGCAGACCAGATGGGCAGGGG + Intronic
1055833152 9:80406629-80406651 ACTGCAGCCCAGAGAGACACAGG + Intergenic
1057125665 9:92614143-92614165 CTTGCAGCCCTGAAGGACCTAGG + Exonic
1057605482 9:96495494-96495516 CTGGCGGCCCACATGGATACTGG + Intronic
1058128164 9:101220466-101220488 CTTATAGTCCAGATGGATACAGG + Intronic
1058425569 9:104873008-104873030 CTTACAGCCCAGCTGGGCCCAGG + Intronic
1058835268 9:108854636-108854658 CCTCCAGCACAGATGGCCACAGG - Exonic
1059642116 9:116227511-116227533 CCTGCAGCCCATCAGGACACTGG + Exonic
1061016930 9:127986739-127986761 CCTGCAGCCCTGATGCCCACAGG + Intergenic
1061577849 9:131518766-131518788 CTTCCAACCCAAGTGGACACGGG + Intronic
1061958130 9:133974187-133974209 CTTGCGGCCCAGGAGGACACAGG - Intronic
1062324310 9:136004979-136005001 CTTGCAGCCCCGACAGAAACCGG - Intergenic
1062353681 9:136152002-136152024 ATTGCAGGCCAGGTGGCCACTGG - Intergenic
1062590774 9:137273582-137273604 GATGTAGCTCAGATGGACACAGG + Intergenic
1187187648 X:17002508-17002530 CTTTCAGTCCAGAGGGACATGGG - Intronic
1188190764 X:27169209-27169231 CTCCCTGCCCAGAAGGACACAGG + Intergenic
1190431606 X:50383124-50383146 CTGACACCCTAGATGGACACAGG - Intronic
1192784224 X:74321832-74321854 CTTGCAGCCCAGCTAGGCAGGGG - Intergenic
1193335657 X:80285495-80285517 CTTCCAGCCCTGATGGACTTGGG - Intergenic
1195571394 X:106401897-106401919 CTTGGACCCCAGAAGGACAGAGG + Intergenic