ID: 915829279

View in Genome Browser
Species Human (GRCh38)
Location 1:159110934-159110956
Sequence CACATTCCATTTACCATCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915829279 Original CRISPR CACATTCCATTTACCATCTA GGG Intronic
901182559 1:7351646-7351668 CACATTCCATTTTCTGTCGAGGG + Intronic
906745712 1:48220979-48221001 GACATTCCTTTTCCCATCTCTGG + Intergenic
907349730 1:53818134-53818156 CACATAAAATTTACCATCTTAGG + Intronic
911110338 1:94176949-94176971 CACATTAAATTTAACATATATGG + Intronic
912180882 1:107217891-107217913 TACATTCCATTTATCAGCCATGG - Intronic
912497462 1:110100746-110100768 CACACTCCATTTACCAAGGAGGG + Intergenic
912789236 1:112635412-112635434 CACATTCCACTTATCAGCAAAGG - Intronic
912949966 1:114113817-114113839 TACAATCCATTTTCCATCTGGGG - Intronic
913372296 1:118114339-118114361 CACCTTCCATTTTCAATATAGGG - Intronic
913681474 1:121189886-121189908 CACCTTCCATTCACCATATAAGG + Intronic
914033307 1:143977523-143977545 CACCTTCCATTCACCATATAAGG + Intergenic
914156138 1:145090444-145090466 CACCTTCCATTCACCATATAAGG - Intronic
915829279 1:159110934-159110956 CACATTCCATTTACCATCTAGGG + Intronic
916315612 1:163444857-163444879 AACATTGCATTTACCACCTCGGG - Intergenic
917229986 1:172825679-172825701 CACATTCTAATTATCACCTAAGG + Intergenic
918662340 1:187105354-187105376 AACATTGAATTTTCCATCTAAGG + Intergenic
919930450 1:202217769-202217791 GACATTCCTTTTACCAACAAGGG + Intronic
920468790 1:206208404-206208426 CACCTTCCATTCACCATATAAGG + Intronic
1063600062 10:7473080-7473102 CAAAGTCCCTTTGCCATCTAAGG + Intergenic
1064123054 10:12636055-12636077 AACATACAATTTACCATCTTAGG + Intronic
1064614043 10:17134446-17134468 CTCATTCCATGTACCATGTATGG - Intergenic
1064869819 10:19924872-19924894 GAAATTCCATTTTCCATCTGGGG - Intronic
1066228187 10:33405022-33405044 CAAATCCCTTTTACCATGTAAGG + Intergenic
1067264237 10:44723395-44723417 CACATTTCATTTTACATCTTAGG + Intergenic
1069389115 10:67913787-67913809 CTCATTCCATTTACCATACTTGG + Intronic
1079720905 11:23812818-23812840 CATTTCCCATTTAGCATCTAGGG + Intergenic
1082198174 11:49328411-49328433 CACATTACATATACAATCCATGG - Intergenic
1089022052 11:115226368-115226390 CATATTCTACTTACAATCTAAGG - Intronic
1089754368 11:120675443-120675465 CACACTCAATTTTCCATCTTTGG + Intronic
1090814287 11:130277722-130277744 TGCATTCAAATTACCATCTAGGG + Intronic
1095255626 12:40032264-40032286 CAAAAGCCATTTACCTTCTACGG + Intronic
1098093032 12:66924345-66924367 CAAATTTCATTTAAAATCTAGGG + Intergenic
1099651126 12:85429484-85429506 CACATTGTATTTTCCATATATGG - Intergenic
1102427091 12:112852346-112852368 CACATGCCATTTATCACATAAGG - Intronic
1103136713 12:118513777-118513799 AGCATTCCATTTGCCATCTGTGG + Intergenic
1103254851 12:119532214-119532236 CACCTTCTATTTACCAGTTATGG + Intronic
1104187689 12:126448475-126448497 CAGATTCCACTCACCATCTCAGG - Intergenic
1104249980 12:127083502-127083524 CACTTTCTATTTAGCATCTCGGG + Intergenic
1104263989 12:127213244-127213266 CAGATCCCTTTTACCATGTAAGG + Intergenic
1107003507 13:35579972-35579994 CACATTCCTTATAAAATCTACGG - Intronic
1109677175 13:65693074-65693096 CACATTCCATTTACCCTAGTAGG + Intergenic
1109880938 13:68475514-68475536 CAAAGTCCATATACCATATATGG - Intergenic
1110311353 13:74053222-74053244 AAAATTCCATTTGCCATTTATGG + Intronic
1110574474 13:77039973-77039995 CAGAGTCCATTTGCCATGTAAGG + Intergenic
1110893682 13:80722183-80722205 CACATTCAATTTTCAATCTCTGG + Intergenic
1115039899 14:28910983-28911005 CAAATTCCATTTACCAAATTTGG - Intergenic
1116630306 14:47322663-47322685 CAGATTCTATTTACCATGTGTGG + Intronic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1130865548 15:87930450-87930472 CACATCCCTTTTACTATCTCCGG + Intronic
1131771516 15:95742884-95742906 AACATTCCTTTTAGCATGTATGG + Intergenic
1132280063 15:100605007-100605029 CTCCTTCCCTTTACCATCTCAGG - Intronic
1133427209 16:5703110-5703132 CACATGGCATTTACAGTCTAAGG + Intergenic
1135232199 16:20719248-20719270 CACATTCCATATGCTATCTGAGG - Intronic
1136745028 16:32579019-32579041 CAGATTCCATTTTTCATCTGGGG - Intergenic
1138276024 16:55735621-55735643 CACATTCCTTTTTCCATTCAAGG - Intergenic
1203024568 16_KI270728v1_random:496203-496225 CAGATTCCATTTTTCATCTGGGG + Intergenic
1203047153 16_KI270728v1_random:838228-838250 CAGATTCCATTTTTCATCTGGGG - Intergenic
1143111285 17:4554399-4554421 CACCTTCTATGTACCTTCTATGG + Intronic
1146914691 17:36671048-36671070 CTCATTCCAAATACCATCTGGGG + Intergenic
1147494802 17:40905442-40905464 CTCTTGCCATTTACCCTCTAGGG - Intergenic
1149435241 17:56628398-56628420 ACCATTCCATTTGCCATCTTTGG + Intergenic
1153179099 18:2412875-2412897 CACATTATATTTACTATATATGG + Intergenic
1153976713 18:10274660-10274682 CACATTCCATAGACCATATTCGG + Intergenic
1156130668 18:33969616-33969638 CAGATACCATATACCATCTATGG - Intronic
1156541340 18:37913916-37913938 GACTTTCCATTTATCTTCTATGG + Intergenic
1159498686 18:69239887-69239909 CACATTCCAGTTACCAGAAAAGG + Intergenic
1162616216 19:11802766-11802788 CACTTTCCAGATACCATCAAAGG + Intronic
1164404182 19:27927974-27927996 CACATTTCACTTACCTTCTGTGG - Intergenic
928084237 2:28335768-28335790 CACATGCCATTTGCCACCTCTGG - Intronic
929902482 2:46017434-46017456 CACATTTCACTTATCATCTATGG + Intronic
933463868 2:82625150-82625172 CAAAATCCATTTTCCATGTATGG - Intergenic
934655707 2:96116064-96116086 CTCATTCTCTTTACCATCTTCGG - Exonic
935634518 2:105239784-105239806 CACATTATATTTACCAACTCTGG + Intergenic
937694796 2:124796749-124796771 AACATTCCATATGCCATTTAGGG + Intronic
937788810 2:125935076-125935098 CAAAGTCCTTTTACCATATAAGG - Intergenic
941183095 2:162285240-162285262 GACTTTCCATTTCCTATCTAGGG - Intronic
943256856 2:185605131-185605153 CTGATTCTATTTAACATCTATGG + Intergenic
945672710 2:212821237-212821259 AACATTCCATTTACCATTGTAGG - Intergenic
946444600 2:219727436-219727458 CCCTTTCTATTTACCATCCAGGG - Intergenic
946552156 2:220813942-220813964 TAGATGCTATTTACCATCTAAGG - Intergenic
1169648137 20:7836827-7836849 GACATTCCATTTTGCAGCTAAGG - Intergenic
1170731451 20:18979281-18979303 CACATCTCATTTGCCATCTAAGG + Intergenic
1174425376 20:50428482-50428504 CACATTCCATTTCACAGATAGGG - Intergenic
1183220698 22:36510916-36510938 CACATTCCACTAAGCATCAAAGG + Exonic
949304037 3:2619438-2619460 AACATTCCATTATCCATCTATGG + Intronic
949852187 3:8430447-8430469 CAAATTCCCTTTGCCATGTAGGG - Intergenic
950985423 3:17358807-17358829 TACATACCATTTACAATTTAAGG + Intronic
951435961 3:22665138-22665160 CACATTGCTTTTGCCTTCTAAGG - Intergenic
952467638 3:33607012-33607034 CAAATTTCAGTTGCCATCTATGG + Intronic
956054385 3:65282944-65282966 AACATTCATTTTAACATCTAAGG - Intergenic
956335225 3:68155685-68155707 CACTTTCCATTTTCCCTTTATGG - Intronic
956528402 3:70189813-70189835 CACATTAGATTTAGCATCTCTGG + Intergenic
956928407 3:74014793-74014815 CACCTTACTTTTAGCATCTATGG + Intergenic
957218364 3:77350398-77350420 CACATTCAATTAACCAAGTAAGG - Intronic
962183685 3:133235560-133235582 CACATCCCATTTTACATCTAGGG - Intronic
963673063 3:148276827-148276849 AACTTTCCCTTTACCATCTAAGG - Intergenic
963702360 3:148642088-148642110 CACATTTCTTTTATCCTCTAAGG - Intergenic
964670206 3:159216725-159216747 CACAGTCCATTTCCCATTAATGG + Intronic
965056647 3:163725647-163725669 AAAGTTCCATTTACCATCTAAGG + Intergenic
966086277 3:176070498-176070520 CACATTCCAATTACCCTGTGAGG - Intergenic
968312547 3:197695978-197696000 CACATTCCATTTCCCACAGAAGG - Exonic
969429603 4:7146384-7146406 CCCATTCCATTAACCATCGAGGG - Intergenic
973054535 4:45639238-45639260 AACATTCCATTTAATATCTCAGG - Intergenic
973847625 4:54929048-54929070 CACTTTCCATTTTCCATCAATGG - Intergenic
974697499 4:65395787-65395809 CAAATTAAATTTATCATCTAAGG + Intronic
976420321 4:84835228-84835250 CAGATTCCATTTATTACCTAAGG + Intronic
977207613 4:94181130-94181152 CAAGTTCCATTTAGCAACTATGG + Intergenic
979279715 4:118851959-118851981 CACATTGCAATTAACCTCTAGGG - Intronic
979352905 4:119666836-119666858 CTCATTCCATCTAACATTTAAGG + Intergenic
983299987 4:165912672-165912694 CACATTCTATTGAACAACTATGG - Intronic
986566525 5:9121098-9121120 CATATTCCATTTACAATATATGG + Intronic
989329586 5:40240780-40240802 CACATTTACTTTACCATCTGTGG + Intergenic
991506738 5:67332813-67332835 AACATTCCATTTAACAACAATGG - Intergenic
993083465 5:83332785-83332807 CAAATTCTATTTACCCTCGAAGG - Intronic
993943754 5:94094312-94094334 CACTTTCTCTTTACCATGTAAGG - Intronic
996292823 5:121874237-121874259 CACATTATATTTAACATCTGTGG + Intergenic
998694249 5:144620824-144620846 CAAAGTCCATTTGCCATATAAGG + Intergenic
1003716934 6:8657937-8657959 TACATTTCATTTCCCTTCTATGG + Intergenic
1003724436 6:8744477-8744499 CTCATTCCATTTCCAATCTTTGG + Intergenic
1004096491 6:12560162-12560184 CACTTTCCATTTGCCATCCCTGG - Intergenic
1009457228 6:63871755-63871777 CACATTCCCTTTGCCAACTGGGG + Intronic
1011464369 6:87640107-87640129 CACATTCCCTTTACAAGATAAGG - Intronic
1011657922 6:89568099-89568121 AACAATCCAATCACCATCTATGG - Intronic
1013160037 6:107534293-107534315 TGCATTCCATTTCCCATCCATGG - Intronic
1021941411 7:25682488-25682510 CAAATTCCAGTCACCATCCAAGG + Intergenic
1023192419 7:37597041-37597063 CACATTAGATTTGCCATCTCTGG + Intergenic
1023573474 7:41597425-41597447 TAGATTCAAATTACCATCTATGG - Intergenic
1026481419 7:70782893-70782915 CAAATTCCATCTACCCTCCAGGG - Intronic
1028538308 7:91914194-91914216 CACATTCCTTTTATCCTTTAAGG + Intergenic
1030355569 7:108538641-108538663 TATATTACATCTACCATCTATGG + Intronic
1031460394 7:122041783-122041805 CACATTCTAATTACCATCTCAGG + Intronic
1032807530 7:135371991-135372013 TACATTCCCTTGACCATCTTTGG - Intronic
1034748864 7:153549711-153549733 CAGAATGCATTTATCATCTATGG - Intergenic
1038784754 8:30601966-30601988 TCCATTCCATTTACATTCTAGGG + Intronic
1042691051 8:71499129-71499151 CACATTCTAAATAACATCTAGGG + Intronic
1045912861 8:107430559-107430581 CAATTTCCTTTTACCATGTAAGG - Intronic
1046537348 8:115532259-115532281 ACCATGCCATTTACCATGTATGG - Intronic
1047655262 8:126970447-126970469 CAAATTCCTTTTACCATGCAAGG + Intergenic
1047894528 8:129351526-129351548 CACATTCTATAAACCATTTAAGG + Intergenic
1048559696 8:135520507-135520529 CACATTTTTTTTTCCATCTAAGG + Intronic
1050418523 9:5438559-5438581 CACATTCCAGATACCATTTGTGG + Intergenic
1051497157 9:17736152-17736174 CACATTTCATTTATAATCTTGGG - Intronic
1054907942 9:70427141-70427163 GACATTCCTTTTACTACCTAAGG - Intergenic
1055909263 9:81328541-81328563 CACTTTCCTTTTGCCATCTTTGG + Intergenic
1059904198 9:118963691-118963713 CACATTTCATTTACCATAGCCGG - Intergenic
1203406537 Un_KI270538v1:23587-23609 CATATTTCCTTTTCCATCTATGG - Intergenic
1186022929 X:5276568-5276590 GACATTACCTCTACCATCTAAGG - Intergenic
1187678498 X:21742066-21742088 CACATTTCATTTTCCACCTGTGG - Intronic
1188857878 X:35220016-35220038 CACAATAAATTTACCATCTCAGG - Intergenic
1189841933 X:45089070-45089092 CACCTTCCATTTACCTTTTAGGG + Intronic
1191744322 X:64469117-64469139 CACCTAATATTTACCATCTATGG + Intergenic
1191754779 X:64581685-64581707 CAGATTCCCTTTACCCACTAAGG + Intergenic
1192046258 X:67677044-67677066 CCCATTCCATTCATTATCTAAGG + Intronic
1194528509 X:95012322-95012344 GATATTCCATATACCATCTGTGG + Intergenic
1194770416 X:97897169-97897191 AACATTTTATTTTCCATCTAGGG - Intergenic
1199592708 X:149482713-149482735 CACATCACATTTGCCATCCATGG + Exonic