ID: 915831707

View in Genome Browser
Species Human (GRCh38)
Location 1:159137353-159137375
Sequence CCCAGCACGTAGGTTTTAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915831707_915831716 19 Left 915831707 1:159137353-159137375 CCTATTAAAACCTACGTGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 69
Right 915831716 1:159137395-159137417 ACCTGTAATCCCAGCACTTTGGG 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122
915831707_915831718 22 Left 915831707 1:159137353-159137375 CCTATTAAAACCTACGTGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 69
Right 915831718 1:159137398-159137420 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
915831707_915831720 28 Left 915831707 1:159137353-159137375 CCTATTAAAACCTACGTGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 69
Right 915831720 1:159137404-159137426 CCCAGCACTTTGGGAGGCTGAGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
915831707_915831714 -9 Left 915831707 1:159137353-159137375 CCTATTAAAACCTACGTGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 69
Right 915831714 1:159137367-159137389 CGTGCTGGGGCTGGGCGTGGTGG 0: 1
1: 5
2: 42
3: 396
4: 2548
915831707_915831715 18 Left 915831707 1:159137353-159137375 CCTATTAAAACCTACGTGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 69
Right 915831715 1:159137394-159137416 CACCTGTAATCCCAGCACTTTGG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915831707 Original CRISPR CCCAGCACGTAGGTTTTAAT AGG (reversed) Intronic
901098182 1:6699640-6699662 CCCATCATCTAGGTTTTAATGGG - Intronic
908939766 1:69417666-69417688 GCCAGCATGTGGCTTTTAATTGG - Intergenic
909118315 1:71568231-71568253 CCCATCAAGGAGGTTTTAAAAGG - Intronic
909710174 1:78640321-78640343 ACCAGAACCTAGGTATTAATTGG + Intronic
913348730 1:117834071-117834093 CCTAGCAGGAAGGTTTTTATAGG - Intergenic
915831707 1:159137353-159137375 CCCAGCACGTAGGTTTTAATAGG - Intronic
923100587 1:230812036-230812058 AACAGCACCTAGATTTTAATAGG + Intergenic
1064247404 10:13679994-13680016 CCCAGCAGGTTGGTTTTAAAAGG + Intronic
1065764232 10:29011859-29011881 CCAAGCAAGTTAGTTTTAATAGG - Intergenic
1069880297 10:71588585-71588607 CTCAGCCTGTAGGTATTAATGGG + Intronic
1070306544 10:75242896-75242918 CCTGGCACGTAGGTGTTAATAGG + Intergenic
1076639644 10:131905547-131905569 CCCAGCACGAAGGTCATGATAGG + Intronic
1079474943 11:20820359-20820381 CACAGCACCTAGTTTATAATAGG - Intronic
1081294947 11:41374177-41374199 GCCAGCACTAAGGTTTGAATTGG + Intronic
1090449517 11:126793895-126793917 CCCACTACCTAGATTTTAATAGG + Intronic
1091834339 12:3575039-3575061 CCCACGAAGTAGGTTTTAATTGG + Intronic
1092737953 12:11601478-11601500 CCCTGCACGTGGCTTTTACTAGG + Intergenic
1097666738 12:62485999-62486021 GCCAGCATGTGGGTTTTAATGGG + Intronic
1099462218 12:82937614-82937636 CCCAGCCGGTAATTTTTAATGGG + Intronic
1100790468 12:98124766-98124788 CACAGCAAGTAGGTTTAAAAAGG + Intergenic
1101469488 12:104983391-104983413 CCCAGCACTGAGCTTGTAATAGG - Intergenic
1101864645 12:108511523-108511545 CCCACCAGGTATGTTTTAAAAGG + Intergenic
1105029976 12:132875186-132875208 ACTAGGAAGTAGGTTTTAATAGG - Intronic
1106841470 13:33688942-33688964 CCAAGGACGAAGGCTTTAATCGG - Intergenic
1110163538 13:72408622-72408644 CCAAGCACATAGATTTTAAAGGG - Intergenic
1111488586 13:88938431-88938453 GCCAGGAAGTAGGCTTTAATAGG - Intergenic
1111639813 13:90953565-90953587 CCCAGCATGTTGGTTCTTATAGG - Intergenic
1119882569 14:78112707-78112729 CCAAGGAAGAAGGTTTTAATTGG + Intergenic
1127716391 15:61653174-61653196 TCCAGCAAGTAGGTGTTACTGGG - Intergenic
1140508603 16:75491050-75491072 CCCAGCACTTTGGATTAAATGGG + Intronic
1144325987 17:14180695-14180717 CCTAAAACGTATGTTTTAATTGG - Intronic
1146824248 17:36009467-36009489 CCCGGCACGCTGCTTTTAATAGG + Intergenic
1160410026 18:78668958-78668980 CCAAGGACTTAGGTTTTAACGGG - Intergenic
1167293504 19:48636759-48636781 CCCCGCACGCAGGTTTCTATGGG + Intronic
1168701046 19:58439790-58439812 CCCAGCCCACAGGTTCTAATGGG - Exonic
931364312 2:61605723-61605745 CCCAGCCGGTTGTTTTTAATTGG - Intergenic
932097741 2:68866540-68866562 CCCAGCCGGTCAGTTTTAATGGG - Exonic
932960050 2:76403006-76403028 CCAAGGAAGAAGGTTTTAATGGG - Intergenic
940071145 2:149689589-149689611 CCCATCACATAGGTGTTTATGGG + Intergenic
1172157141 20:32835475-32835497 CCCAGCAAGCATGTTTTAATAGG + Intronic
1173945999 20:46951486-46951508 CCCAGGATGTAGGTTATAACTGG - Intronic
1180822772 22:18842988-18843010 TCCAGCAAGTAGTTTGTAATGGG + Intergenic
1181190191 22:21133038-21133060 TCCAGCAAGTAGTTTGTAATGGG - Intergenic
1181209011 22:21277486-21277508 TCCAGCAAGTAGTTTGTAATGGG + Intergenic
1181502892 22:23328711-23328733 TCCAGCAAGTAGTTTGTAATGGG - Intergenic
1181653693 22:24277087-24277109 CCCAGTAAGTAGTTTGTAATGGG - Intronic
1203217928 22_KI270731v1_random:17962-17984 TCCAGCAAGTAGTTTGTAATGGG - Intergenic
1203272909 22_KI270734v1_random:68895-68917 TCCAGCAAGTAGTTTGTAATGGG + Intergenic
949402698 3:3682605-3682627 CCACGAAAGTAGGTTTTAATGGG - Intergenic
952041462 3:29266767-29266789 CCCAGCACCTAGAACTTAATAGG - Intergenic
964470980 3:157055399-157055421 CCCATCACAGAGCTTTTAATGGG - Intergenic
967415836 3:189217560-189217582 TCCTGAAAGTAGGTTTTAATGGG - Intronic
971386783 4:26148003-26148025 CTCAGCAAGTTGGTTTTAACAGG + Intergenic
975889903 4:79015286-79015308 TGCAGCACCTAGGTTATAATTGG + Intergenic
980096469 4:128496383-128496405 CCCTGCTGGTAGGTTTTGATGGG + Intergenic
981906489 4:149927022-149927044 CCAAGGAAGTAGGTTCTAATGGG - Intergenic
987988356 5:25179411-25179433 TCCAGCCCGTATTTTTTAATTGG + Intergenic
988149315 5:27355820-27355842 CTAAGTATGTAGGTTTTAATGGG - Intergenic
989426933 5:41306482-41306504 CCCAGCAGGTAGGGTTTACTTGG + Intergenic
989952780 5:50320198-50320220 CCCAGAACACAGGTGTTAATGGG + Intergenic
990983202 5:61619815-61619837 CCCAGCATGTATTTGTTAATGGG + Intergenic
992678058 5:79125640-79125662 CCCAGCAGGAAGCTTTTAATTGG - Intronic
993105925 5:83600620-83600642 CCTAGCATGTAGTTTTTAAAAGG + Intergenic
994724250 5:103416014-103416036 CCAGGCACATAGGTTCTAATTGG - Intergenic
996690886 5:126338624-126338646 CACAGCTCCTAGATTTTAATGGG - Intergenic
996997123 5:129711038-129711060 CCCTGCAAGTTGATTTTAATTGG - Intronic
998300758 5:141017459-141017481 AACAGAACGTAGGTTTTTATGGG - Intergenic
1001370770 5:171198566-171198588 CCCAGCAATTTTGTTTTAATAGG - Intronic
1008638880 6:53440786-53440808 CCCAGGAGGTAGATTTTTATAGG + Intergenic
1012524126 6:100156738-100156760 CCCAGAAATTAGGTTTTACTGGG + Intergenic
1015062855 6:128988164-128988186 CCTAGCATGTAGTTTTTAAAAGG + Intronic
1021081354 7:16369570-16369592 CACAGAACTGAGGTTTTAATAGG + Intronic
1024654796 7:51442548-51442570 CCAAGGAAGAAGGTTTTAATTGG + Intergenic
1028220517 7:88190882-88190904 CCCAGCAGGAAGGTTTTAGCAGG - Intronic
1028465464 7:91146494-91146516 CCCAGCGCTGAGGTTCTAATTGG + Intronic
1034201063 7:149283269-149283291 CCCAGCCTGTGGGTTTTGATGGG + Exonic
1034324544 7:150219215-150219237 CCCAACAAGTAGATTTTAATGGG + Intergenic
1034768649 7:153750016-153750038 CCCAACAAGTAGATTTTAATGGG - Intergenic
1188908149 X:35812894-35812916 CCAAGGACGAAGGCTTTAATTGG + Intergenic
1200305126 X:155017271-155017293 GCCAACACCAAGGTTTTAATAGG - Intronic