ID: 915837252

View in Genome Browser
Species Human (GRCh38)
Location 1:159187827-159187849
Sequence CCTTCTGTGCACATGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 318}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915837252_915837260 -4 Left 915837252 1:159187827-159187849 CCATCCTCCATGTGCACAGAAGG 0: 1
1: 0
2: 2
3: 23
4: 318
Right 915837260 1:159187846-159187868 AAGGTAGTAGGGTGAGTGTGGGG 0: 1
1: 0
2: 0
3: 33
4: 306
915837252_915837261 4 Left 915837252 1:159187827-159187849 CCATCCTCCATGTGCACAGAAGG 0: 1
1: 0
2: 2
3: 23
4: 318
Right 915837261 1:159187854-159187876 AGGGTGAGTGTGGGGCACTCAGG 0: 1
1: 0
2: 5
3: 30
4: 252
915837252_915837259 -5 Left 915837252 1:159187827-159187849 CCATCCTCCATGTGCACAGAAGG 0: 1
1: 0
2: 2
3: 23
4: 318
Right 915837259 1:159187845-159187867 GAAGGTAGTAGGGTGAGTGTGGG 0: 1
1: 0
2: 0
3: 21
4: 242
915837252_915837263 19 Left 915837252 1:159187827-159187849 CCATCCTCCATGTGCACAGAAGG 0: 1
1: 0
2: 2
3: 23
4: 318
Right 915837263 1:159187869-159187891 CACTCAGGGAGAGCCCCTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 259
915837252_915837258 -6 Left 915837252 1:159187827-159187849 CCATCCTCCATGTGCACAGAAGG 0: 1
1: 0
2: 2
3: 23
4: 318
Right 915837258 1:159187844-159187866 AGAAGGTAGTAGGGTGAGTGTGG 0: 1
1: 0
2: 1
3: 30
4: 390
915837252_915837262 5 Left 915837252 1:159187827-159187849 CCATCCTCCATGTGCACAGAAGG 0: 1
1: 0
2: 2
3: 23
4: 318
Right 915837262 1:159187855-159187877 GGGTGAGTGTGGGGCACTCAGGG 0: 1
1: 0
2: 4
3: 41
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915837252 Original CRISPR CCTTCTGTGCACATGGAGGA TGG (reversed) Intronic
900129139 1:1080258-1080280 CCTCCTGTGCCCAGTGAGGAGGG + Intergenic
901049054 1:6417141-6417163 CCCTCTGGGCACAGGGAGGTGGG + Exonic
901106137 1:6758133-6758155 CCTGCTGTGCACACGCAGGGTGG + Intergenic
902007628 1:13244994-13245016 GCTACTCTGCACATGGAGGTGGG - Intergenic
902478632 1:16700562-16700584 CCTGCTGTGCACCTGGCGGCGGG + Intergenic
902719828 1:18296542-18296564 CCCTCTCTGTACCTGGAGGAAGG - Intronic
903271372 1:22190452-22190474 GCATCTGGGCAGATGGAGGACGG + Intergenic
904783700 1:32969701-32969723 ACATCTGTGGTCATGGAGGATGG + Intergenic
905196741 1:36285555-36285577 CCTTCTGTGCACACCGGGGTGGG + Intronic
905476179 1:38229733-38229755 CCCTCTCTGCTCATGGAGGCTGG + Intergenic
905875370 1:41428687-41428709 CCTTCTGTTCTCATGGTGGCTGG - Intergenic
911241473 1:95471740-95471762 CAATCTGTGCACTTGGGGGAGGG - Intergenic
912703525 1:111895670-111895692 CATTCTGAGCATATGGAGAAGGG - Intronic
915537338 1:156544891-156544913 CTTTCTGTGCACATGAGGGAGGG - Intronic
915837252 1:159187827-159187849 CCTTCTGTGCACATGGAGGATGG - Intronic
916653045 1:166848694-166848716 CCTTCTTTGCAGATGAAGAAGGG - Intronic
917687407 1:177431398-177431420 TCTCAAGTGCACATGGAGGAAGG - Intergenic
918994858 1:191744175-191744197 CCTTGTCTTCACATGGTGGAAGG + Intergenic
920206838 1:204298473-204298495 TCTTTTCTGCACATGGAGAATGG + Intronic
920646788 1:207809606-207809628 CATTCTGTCCACTTGAAGGATGG - Intergenic
920661509 1:207919456-207919478 CATTCTGAGCACATAGAGCAAGG + Intergenic
920987287 1:210902443-210902465 ACCTCTGTGCACATGGTGGTGGG + Intronic
921196581 1:212763021-212763043 CCTTATGGGCATATGGAGAAAGG + Intronic
921482492 1:215679063-215679085 GCTTCTGTCCACATGTAGGCAGG + Intronic
922762128 1:228139849-228139871 CCTGCAGTGTAGATGGAGGACGG + Intergenic
923286242 1:232498647-232498669 CTTGCTGTGAAGATGGAGGAAGG - Intronic
1062855071 10:775923-775945 CCTTCTGGTCACCTGGTGGACGG + Intergenic
1063676289 10:8143209-8143231 CCTTCAGGGGACATGGAGTAAGG - Intergenic
1066326592 10:34366327-34366349 CCTTCTGAGCACATGAGGTAGGG + Intronic
1066575644 10:36821333-36821355 TGTTCTGTGCCAATGGAGGAGGG - Intergenic
1066646886 10:37619334-37619356 TTTTATGTGAACATGGAGGAAGG + Intergenic
1067282316 10:44881726-44881748 CCTTCTGTGCACCTGGAGCATGG - Intergenic
1068088972 10:52409163-52409185 TCTGCTGTGAACCTGGAGGAGGG - Intergenic
1069911532 10:71762618-71762640 CCCTCAGGGCACTTGGAGGAGGG + Intronic
1070746343 10:78936161-78936183 CCTTCTGGGCAAATGGAAGAGGG - Intergenic
1072492504 10:95921336-95921358 GAATCTGTGCACTTGGAGGAGGG - Intronic
1072763753 10:98079819-98079841 CCTCCAGGGCACATGGAGAACGG - Intergenic
1073207847 10:101778123-101778145 CCTACTGTGTACAAGGATGAGGG - Intronic
1073827216 10:107337497-107337519 GAATCTGTGCACTTGGAGGAGGG - Intergenic
1074964189 10:118474191-118474213 CCTTCTCTGCAAATAGCGGATGG - Intergenic
1077139005 11:1015342-1015364 CTCTCTCTGCACTTGGAGGAAGG + Intronic
1078014446 11:7601124-7601146 CCTCTTGTGCTCCTGGAGGAAGG - Intronic
1078655320 11:13233444-13233466 CCTTCAGTGCACATTTAGAAGGG - Intergenic
1078773126 11:14369453-14369475 CCTTCTGTGCCCATGGGGCAAGG + Intergenic
1079666462 11:23112605-23112627 CCTTCTGTGTAAATGAAGCAGGG - Intergenic
1079966473 11:26986228-26986250 CCTTCTTTGCACATGCTGGTAGG + Intergenic
1083762568 11:64826694-64826716 CCTTCGCTGCCCATGGAGGCTGG + Exonic
1085525641 11:77161947-77161969 CCTCCTCTGCACCTGGAGGGAGG + Intronic
1086289155 11:85286445-85286467 CCTTCTCAGCAGATGGAGCAAGG - Intronic
1087009961 11:93503759-93503781 GAGTCTGTGCACATGGAGCACGG + Intronic
1088860934 11:113799092-113799114 CCTTCTTTACACATGCAGCATGG + Exonic
1091288904 11:134425913-134425935 CCTTCACAGCACATAGAGGAGGG - Intergenic
1091781958 12:3219474-3219496 CCTTCTGTGAGGATGGAGGGAGG + Intronic
1092563049 12:9636854-9636876 CGTCCTGTGCACTGGGAGGATGG - Intergenic
1093093028 12:14942432-14942454 CCAGCTGTGGACAGGGAGGAGGG + Exonic
1093549832 12:20394986-20395008 CCTTCTTTCCATATGGAGTATGG - Intronic
1097274770 12:57805473-57805495 ACTTCTATGCAGATGGAGGCTGG - Intronic
1098395200 12:70010194-70010216 CAATCTGTGCACTTGGGGGAGGG + Intergenic
1098563875 12:71908980-71909002 CCTTCTGTTCCCAAGGAGAATGG - Intronic
1099091231 12:78311809-78311831 CCTTATGTTCACATGATGGAAGG - Intergenic
1099869926 12:88334310-88334332 CATTCAGTGCACAAGGAGGTGGG + Intergenic
1101800987 12:108021786-108021808 CCTTCAGAGCACAGGGAGGGTGG + Intergenic
1102097050 12:110249277-110249299 GCTTCTTTCCACATGGAGGACGG - Intergenic
1102285575 12:111653644-111653666 CCTTCTGTTGATGTGGAGGAGGG - Intronic
1102646425 12:114406725-114406747 CCTTGTGTACACCTGGAGCAGGG - Intronic
1103041686 12:117701045-117701067 CCTATTGTGCAGATGGAGGATGG - Intronic
1103409479 12:120700492-120700514 CCTTCTGTGGCCCCGGAGGAAGG + Exonic
1103741508 12:123094646-123094668 GCATCTGTGCAGATGGAGGACGG - Intronic
1103917845 12:124385182-124385204 CCTTCTGTGCTTGTGGAGGAGGG + Intronic
1104975841 12:132551652-132551674 CAGTCTGTTCACGTGGAGGAGGG - Intronic
1105777882 13:23679981-23680003 CCTTCTGGGGACAGTGAGGAGGG + Intergenic
1107210754 13:37851810-37851832 AAGTCTGTGCACTTGGAGGAGGG + Intronic
1107615879 13:42167566-42167588 CCTTCTGGTCACATGGATGTTGG + Intronic
1109863638 13:68232950-68232972 CCACCTGTGCACTGGGAGGATGG - Intergenic
1110289315 13:73785877-73785899 CCTTCTGGGCAGATAGCGGAAGG + Intronic
1111217699 13:85165432-85165454 TCTTATGTGGACTTGGAGGAGGG + Intergenic
1111508996 13:89235656-89235678 TATTCTGTCCACATGAAGGAAGG - Intergenic
1112262996 13:97894754-97894776 CCTTCTATGCACATGGACAATGG + Intergenic
1112656036 13:101453603-101453625 ACCTCTGTCCACCTGGAGGAAGG + Intronic
1113367888 13:109693697-109693719 CCTTCCGTTCACATGAAGGCGGG - Intergenic
1116485764 14:45446143-45446165 TCTTCTGTGCTCTTGGAGGAGGG - Intergenic
1117283908 14:54267448-54267470 AGTTTTGTGCACATGGAGGTTGG - Intergenic
1117385943 14:55212891-55212913 CCTTCTGTGCACAATGAGCTTGG + Intergenic
1120610690 14:86637449-86637471 CCTGCTGTGCACATGTTTGAAGG + Intergenic
1120656280 14:87193854-87193876 TCCTCTGTGCACATGAAGGAAGG - Intergenic
1121546106 14:94764840-94764862 CCTAGTTTGCACATGGAAGATGG - Intergenic
1122398212 14:101450356-101450378 TGTTCTGTGCACATGGATGTTGG - Intergenic
1122623464 14:103072642-103072664 CCTTATCTGCACAGTGAGGAGGG - Intergenic
1125102635 15:35932706-35932728 CCATCTGTGAACCAGGAGGAGGG - Intergenic
1126181961 15:45794021-45794043 CCCTCTGTGCAGAAGGAGGGAGG + Intergenic
1128646629 15:69383300-69383322 CCCTCCGTGCTCATGGTGGAGGG + Intronic
1128646638 15:69383331-69383353 CCCTCCGTGCTCATGGTGGAGGG + Intronic
1128646660 15:69383422-69383444 CCCTCCGTGCTCATGGTGGAGGG + Intronic
1128646669 15:69383453-69383475 CCCTCTGTGCTCATGGTGGAGGG + Intronic
1128646697 15:69383574-69383596 GCCTCTGTGCTCATGGTGGAGGG + Intronic
1128646725 15:69383695-69383717 GCCTCTGTGCTCATGGTGGAGGG + Intronic
1128646732 15:69383725-69383747 GCCTCTGTGCTCATGGTGGAGGG + Intronic
1128646739 15:69383755-69383777 GCCTCTGTGCTCATGGTGGAGGG + Intronic
1128646802 15:69384026-69384048 GCCTCTGTGCTCATGGTGGAGGG + Intronic
1128646809 15:69384056-69384078 GCCTCTGTGCTCATGGTGGAGGG + Intronic
1128646817 15:69384087-69384109 GCCTCTGTGCTCATGGTGGAGGG + Intronic
1128646824 15:69384117-69384139 GCCTCTGTGCTCATGGTGGAGGG + Intronic
1128646831 15:69384147-69384169 GCCTCTGTGCTCATGGTGGAGGG + Intronic
1128646963 15:69384631-69384653 CCCTCTGTGTTCATGGTGGAGGG + Intronic
1130094759 15:80847694-80847716 CCTTCTGAGCCCATGGAGTGAGG - Intronic
1131236377 15:90700519-90700541 CCTTTTGTACACAAGAAGGAAGG + Intergenic
1133414295 16:5594184-5594206 CCTTCTGTTAACCTGTAGGATGG + Intergenic
1133427014 16:5701449-5701471 CATCCTTTGTACATGGAGGAAGG - Intergenic
1134080201 16:11319699-11319721 CCTGCTCTGCAAAGGGAGGATGG - Intronic
1134100324 16:11447407-11447429 TCTTCTGGGCACATGGAAAATGG - Intronic
1134847874 16:17456104-17456126 CACTCTGTGCACACAGAGGATGG + Intronic
1135718529 16:24794398-24794420 CCTTCTGTGCAGATGCAGGAAGG + Intronic
1136173510 16:28502513-28502535 GAGTCTGGGCACATGGAGGAAGG - Intronic
1136381638 16:29898836-29898858 TCTTCCGAGCACATGGGGGAGGG - Intronic
1139025613 16:62814352-62814374 CCTTCTGGAAACATGGATGAGGG - Intergenic
1140545601 16:75805857-75805879 GCTTCTGTGCCCATGGAGTTGGG - Intergenic
1140894341 16:79311821-79311843 ACTTCTGTGGGCATGAAGGACGG + Intergenic
1141330732 16:83108570-83108592 CCACCTGTGCACTGGGAGGATGG - Intronic
1141896520 16:86962163-86962185 CCTTCTGAGGACATGAAGAAAGG + Intergenic
1142482054 17:225163-225185 GCCTCTGAGCAGATGGAGGAAGG - Intronic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1143561479 17:7698230-7698252 CATTCTGTACACATGTAGAAGGG - Intronic
1145265051 17:21375945-21375967 TCATATGTGCACATGCAGGATGG - Intergenic
1146282904 17:31557128-31557150 CCTTCTCTGCCCCTGGAGGCAGG + Intergenic
1146756728 17:35439135-35439157 GTTTGTGTGCACAGGGAGGAAGG + Exonic
1146910931 17:36647986-36648008 ACATCTGTGCACATGGGGGTGGG - Intergenic
1149033653 17:52110788-52110810 CCTTCTGTGCCCACAAAGGAAGG - Intronic
1151877074 17:76872942-76872964 CCTTCTGTGCGGATGGTGAATGG - Exonic
1152026195 17:77811031-77811053 ACATCTGGGCACATGGAGGCTGG - Intergenic
1155178438 18:23322005-23322027 CCTTCTCTGCCCACGGAGGAGGG + Intronic
1155226562 18:23734411-23734433 CCTTCAGTACACATGGGGCATGG + Intronic
1156513537 18:37661190-37661212 ACTTCTGTGGGCATGGAGGGGGG + Intergenic
1157320294 18:46629061-46629083 CCTTTTGCCCCCATGGAGGAGGG + Intronic
1158033738 18:52999448-52999470 GCTTCTGTGCGGATGGAGCATGG + Intronic
1159065927 18:63567903-63567925 CCTTCTGGCCACGTGGAGGCTGG + Intergenic
1159065937 18:63567948-63567970 CCTTCTGGCCACGTGGAGGCTGG + Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1161420560 19:4174236-4174258 CCTGCAGGGCCCATGGAGGAGGG + Exonic
1162106151 19:8371044-8371066 CTTTCTGGGCAGATGGAGGCTGG + Exonic
1163850407 19:19659865-19659887 CCTGCTGGGCTCCTGGAGGAGGG - Intronic
1165006621 19:32812709-32812731 CCTTCTGTGGGAATGGAGAAAGG + Intronic
1165862183 19:38915118-38915140 CCCCCAGTGCACATGGAGGCTGG - Intergenic
1167552008 19:50167817-50167839 CCGTGTGTGCATGTGGAGGAAGG - Intergenic
1168189235 19:54725982-54726004 TCTTCTGAGCACAGGGAGGGAGG + Intronic
1168199515 19:54804722-54804744 TCTTCTGAGCACAGGGAGGGAGG + Intronic
1168203949 19:54835771-54835793 TCTTCTGAGCACAGGGAGGGAGG + Intronic
1168206130 19:54851927-54851949 TCTTCTGAGCACAGGGAGGGAGG + Intronic
1168449859 19:56457937-56457959 CTGTGTCTGCACATGGAGGAAGG - Intronic
1202712651 1_KI270714v1_random:26393-26415 CCTGCTGTGCACCTGGCGGCGGG + Intergenic
926213112 2:10886075-10886097 CTTTCTGTGCACATGCATGGAGG - Intergenic
927454395 2:23237267-23237289 ACTACTGTGCACATGGAAGGTGG - Intergenic
928312403 2:30221781-30221803 CCTTCTGTACACAGGGAAGCGGG - Intergenic
928990395 2:37227050-37227072 CCTCCTGTGCACCTAGAGCATGG + Intronic
929760390 2:44801864-44801886 CCCTCTGCGCCCCTGGAGGACGG - Intergenic
931046275 2:58357513-58357535 CCTTTTGTGCATGTGAAGGAGGG + Intergenic
935333037 2:101991241-101991263 CCTCCTGTTCATATGAAGGAAGG + Intergenic
935809364 2:106782009-106782031 TTTTCTGGGCAAATGGAGGAAGG + Intergenic
936103140 2:109600977-109600999 GCTTCTGTCCCCATGGAGGAGGG + Intronic
937797111 2:126036682-126036704 ACTTGTGTGTATATGGAGGATGG + Intergenic
938058446 2:128233776-128233798 CCACCTTTGCACAGGGAGGAAGG - Intergenic
939529940 2:143345932-143345954 CCTTCTGTGGGCAGAGAGGAGGG + Intronic
940209626 2:151243046-151243068 CATTTTGTGCACATGGAGTGGGG + Intergenic
942841151 2:180362458-180362480 CCTTTTGTGCACTCAGAGGATGG - Intergenic
942955848 2:181772568-181772590 CCTTGGGTGTTCATGGAGGAGGG + Intergenic
943109938 2:183592433-183592455 CCCTCTGTGCACAATGAGCAGGG - Intergenic
944515913 2:200511441-200511463 CCTTCTGCAGAGATGGAGGAAGG + Intronic
944586486 2:201178103-201178125 CCCCCTGTGCTCTTGGAGGAGGG + Intergenic
945468633 2:210201085-210201107 CCACCTGTGCACTGGGAGGACGG + Intronic
945655260 2:212615540-212615562 CCTTCTGTTCACATAGATAATGG + Intergenic
946520944 2:220464104-220464126 CCATCTGTGAACCGGGAGGAAGG - Intergenic
946577873 2:221095944-221095966 ACTTCTGTGCCCATGGAAGCTGG - Intergenic
946652964 2:221913926-221913948 TCTCCTGTGCACTGGGAGGATGG - Intergenic
946740923 2:222800345-222800367 GCGCCTGGGCACATGGAGGAAGG + Intergenic
947365914 2:229394721-229394743 ACTTCTGTGGCCATTGAGGACGG + Intronic
947593039 2:231395871-231395893 CCGTCTGTGGCCACGGAGGAGGG - Intronic
947757765 2:232580512-232580534 CCTTCTGTGTAAATGGGGGTAGG - Intronic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
1169587922 20:7107264-7107286 CCATCTGTGAACCAGGAGGAAGG + Intergenic
1169860041 20:10141550-10141572 GCTTGTGGGCACATGGAGAATGG - Intergenic
1172322184 20:34004162-34004184 CTTCCTTTGTACATGGAGGAGGG + Intronic
1172877173 20:38171575-38171597 CATTCTGTGCAGATAGAGCAGGG + Intergenic
1173086556 20:39924969-39924991 ACTTCAGTGCCCATGGAAGATGG - Intergenic
1173264283 20:41464675-41464697 CCCTCTGTGCACATGGAGCTAGG - Intronic
1175013377 20:55763126-55763148 CCTTCTATGCACATCGATTATGG - Intergenic
1175886234 20:62292415-62292437 GCGTCTGTGCACATGGAGGCTGG + Intronic
1176075568 20:63246808-63246830 CTTTCTGAGCACTTCGAGGAAGG + Intronic
1176122608 20:63460858-63460880 CCACCTGTGGACATGGATGACGG - Intronic
1179834502 21:44020961-44020983 CCATCTGTTCACATGGAAGCAGG + Intronic
1180249147 21:46568159-46568181 CCCTCTGTGAGCAGGGAGGATGG - Exonic
1183812826 22:40272222-40272244 CTGTCTGTGCACAAGGGGGAGGG - Intronic
1184073719 22:42162992-42163014 CCTTCTGTGTTCTTGGAGGTAGG - Intronic
950728944 3:14939403-14939425 GATTCTGTGCACAGGCAGGATGG + Intergenic
950874283 3:16256029-16256051 CCTGCTTTGCACATGGACCAAGG - Intergenic
951187652 3:19732963-19732985 TCTTCTGTGAACATGCTGGAAGG - Intergenic
951310371 3:21117822-21117844 GAATCTGTGCACTTGGAGGAGGG - Intergenic
951495168 3:23317407-23317429 CAATCTGTGCACTTGGGGGACGG - Intronic
952518013 3:34125156-34125178 GAATCTGTGCACTTGGAGGAAGG - Intergenic
953435860 3:42876646-42876668 TACTCTGTGCACATGGAGGTAGG - Intronic
953589620 3:44238989-44239011 CCGTCTGTGGACATTGAGGAAGG - Intergenic
953727481 3:45412903-45412925 CCATCTGTGCACTGGAAGGATGG - Intronic
954734925 3:52699219-52699241 TCTTCTGTGCCTATGGATGATGG - Intronic
954989235 3:54825255-54825277 CCTTCTGTGTAGAAGGAAGAAGG - Intronic
955423638 3:58764765-58764787 CTCTCTGAGCACATGCAGGAAGG + Intronic
956041459 3:65149483-65149505 TCATCTGAGGACATGGAGGAAGG - Intergenic
956627182 3:71278338-71278360 GCTTCTGTGCTCATAAAGGAGGG - Intronic
956636110 3:71367161-71367183 ACTTCTGTGCAGAAGGAGGGAGG + Intronic
956803442 3:72785120-72785142 CTCTCACTGCACATGGAGGATGG - Intronic
960167524 3:114420485-114420507 CCGCCTGTGCACATACAGGAAGG + Intronic
960234542 3:115266637-115266659 CCTACTGTGCCCAGGGAGAATGG + Intergenic
960554150 3:119009003-119009025 GCTTCTGTGTATATGGAGGCTGG - Intronic
960862917 3:122169519-122169541 GACTCTGTGCACTTGGAGGAGGG - Intergenic
962000118 3:131287081-131287103 CCATCTGTGCCCATGGAAGCTGG + Intronic
962911628 3:139856246-139856268 CAATCTATGCACAGGGAGGATGG + Intergenic
963171368 3:142254674-142254696 CCATCTGTGCACTGGGAGAATGG + Intergenic
964072027 3:152646776-152646798 CCTTCTGAGCACATTGAGCTGGG - Intergenic
964792308 3:160463679-160463701 CCCTCTGTTCAAATGCAGGAAGG + Intronic
965036902 3:163451262-163451284 ACTTCTGTGCACCTGCAGGAAGG - Intergenic
965538436 3:169848846-169848868 CCTTCACTTCACATGTAGGAAGG + Intronic
966302488 3:178495107-178495129 GCTCCTGGGCACCTGGAGGATGG - Intronic
966547812 3:181170599-181170621 GCTTCTGGGGACTTGGAGGAGGG - Intergenic
968483479 4:847718-847740 CCTTGTGTCCACGTGCAGGACGG + Intergenic
969870693 4:10102730-10102752 GCTGCTGTGCACACGCAGGATGG + Intronic
970219676 4:13797836-13797858 TCTTCTATGGACATGGGGGATGG + Intergenic
971614573 4:28771383-28771405 CCTTGTCTTCACATGGTGGAAGG + Intergenic
972086204 4:35219918-35219940 CATAATGTGGACATGGAGGATGG - Intergenic
973766432 4:54167492-54167514 CCATGTCTGCACATGGTGGAAGG + Intronic
977748608 4:100581039-100581061 CCATCTATGAACATGGAGAAGGG + Intronic
979621623 4:122804809-122804831 CTTTCTGTACACTGGGAGGAAGG - Intergenic
981189957 4:141851166-141851188 CCACCTGTGCACTGGGAGGACGG + Intergenic
981344079 4:143655012-143655034 CCTGGTGTGGAAATGGAGGATGG - Intronic
981396167 4:144252468-144252490 GCTTCTGTGCTCATGGAGTTGGG - Intergenic
982101637 4:151974188-151974210 GTTTCTGTGCACTTGGAGGCAGG + Intergenic
982446559 4:155497495-155497517 CCTTGTGTCCACATGGTGGAAGG + Intergenic
982477539 4:155872179-155872201 CCACCTGTGCACTGGGAGGATGG - Intronic
984463092 4:180059606-180059628 CCTTCCGTGCAGAAGGAGCAAGG - Intergenic
984709362 4:182872260-182872282 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
985855531 5:2421673-2421695 CCTGCAGTGCTCATGCAGGAAGG + Intergenic
986512720 5:8525228-8525250 CCTTCTGTCCCCATGGAGTTGGG - Intergenic
986855655 5:11865831-11865853 CGGTCTTTGAACATGGAGGAAGG + Intronic
988109576 5:26800794-26800816 CCTTCAATGGACATGGAGGGTGG - Intergenic
989657817 5:43762889-43762911 GAATCTGTGCACTTGGAGGAGGG - Intergenic
990751626 5:59022664-59022686 CCTTCTGTGCACATGTTAGAGGG + Intronic
993526207 5:88968876-88968898 ACTTCAGGGCACATGGAAGATGG + Intergenic
994944829 5:106374001-106374023 CGCTCTCTGCAGATGGAGGATGG - Intergenic
995037139 5:107547142-107547164 CCTACTGTACACATGGATCATGG + Intronic
997077171 5:130692874-130692896 CGTTTTGTGCACATGGAGATAGG - Intergenic
997563077 5:134865691-134865713 CCTTCTGTGCACATGCATGCAGG - Intergenic
999153456 5:149441939-149441961 GCTCCTGTGCAGCTGGAGGAAGG + Intergenic
999443061 5:151617365-151617387 CCTTCTGGGCCTGTGGAGGAAGG + Intergenic
1002360947 5:178670435-178670457 CCTTCTGTGTACACTGGGGATGG - Intergenic
1002653322 5:180720824-180720846 CCATCTGGGCACATGGAGGTAGG + Intergenic
1002693790 5:181070627-181070649 CCCTCTGTGCTCTTGGGGGAGGG - Intergenic
1003163346 6:3654919-3654941 CCCTCAGTGCACATGCAGGGAGG + Intergenic
1003374218 6:5559897-5559919 GCTTCTGTGTAAATGGAGCAGGG + Intronic
1003470168 6:6422141-6422163 CCTTGGGTTAACATGGAGGAAGG - Intergenic
1003889739 6:10553451-10553473 GATGCTGAGCACATGGAGGAGGG + Intronic
1004153896 6:13149627-13149649 CCTACTGTGATCATGGGGGAGGG + Intronic
1005089746 6:22043818-22043840 CATGCTGTGCTGATGGAGGAGGG + Intergenic
1006902241 6:37510727-37510749 CATGGTGTGCACAGGGAGGAGGG + Intergenic
1007094164 6:39203277-39203299 CCCTCAGGCCACATGGAGGAAGG + Intronic
1007643666 6:43363896-43363918 GCCTCTGTGCACAGGGAGAATGG - Intronic
1007725829 6:43915071-43915093 CAGCCTGGGCACATGGAGGAGGG + Intergenic
1007973093 6:46072771-46072793 CCTTGTGTGCCCATGTGGGAGGG - Intronic
1008735619 6:54540101-54540123 CCTTTCCTGCACATGGAGAATGG - Intergenic
1012363362 6:98409920-98409942 CCATCTGTGAACAAGGAGGCAGG - Intergenic
1012797173 6:103776997-103777019 CCTCCTGTCCACATCAAGGAGGG + Intergenic
1015804012 6:137090338-137090360 CCATCTGTGCACCAGGAAGAGGG + Intergenic
1016792483 6:148079919-148079941 CCTCCTGGGCACATGGACTATGG + Intergenic
1017243560 6:152197082-152197104 GCATCTGTGCATATCGAGGAAGG - Intronic
1017719674 6:157235967-157235989 CCTGGGGTGCACACGGAGGAGGG + Intergenic
1017743024 6:157423794-157423816 CCATCTGTGGATTTGGAGGATGG + Intronic
1017854735 6:158340424-158340446 CCCTGTGTGCACACAGAGGAGGG - Intronic
1018581888 6:165315085-165315107 CCGGCTTTGCAGATGGAGGAAGG - Intergenic
1019073354 6:169367689-169367711 CCCTCTGTGCACATGGACACAGG - Intergenic
1019181298 6:170188687-170188709 TCTTCTGTGCACTGGGAGCAGGG + Intergenic
1019598002 7:1867264-1867286 CCTTCGGGGCTAATGGAGGAGGG + Intronic
1019781076 7:2940046-2940068 CCTTCTCTGCCCGTGGAAGAAGG - Intronic
1021202476 7:17741837-17741859 ACTTCTGTGCACCTGCAGCAAGG + Intergenic
1021611859 7:22465593-22465615 CCTTCCTTGCACATGCAGTAGGG + Intronic
1022044253 7:26610725-26610747 CCTTCTGTTCTCAGGGAAGAGGG - Intergenic
1023377552 7:39573755-39573777 TCTTCTGTGAACTTTGAGGAGGG - Intronic
1023640430 7:42251449-42251471 CCTGCTGTGCAGCTGGAGTAGGG + Intergenic
1024045039 7:45580230-45580252 CCTGCTGGGCACATTGTGGAGGG - Intronic
1024054520 7:45651376-45651398 CCTGCCTTGCACATGCAGGATGG + Intronic
1025249338 7:57341625-57341647 CCTTCTGTTGATATGCAGGATGG + Intergenic
1025781078 7:64602310-64602332 CCATCTGTGAGCATGGAGCAAGG - Intergenic
1025830691 7:65046579-65046601 GGTTCTGGGCACATGGAGGGAGG + Intergenic
1025917858 7:65880491-65880513 GGTTCTGGGCACATGGAGGGAGG + Intronic
1028654515 7:93188331-93188353 GCTTCTGTGAAAATGCAGGAAGG + Intergenic
1031427309 7:121621363-121621385 CCAGCTGTGCAGAGGGAGGACGG - Intergenic
1034787751 7:153940952-153940974 CCATCTCTGCACATGGGAGAGGG + Intronic
1034954707 7:155327375-155327397 CTTTCTGTCCAGGTGGAGGAGGG - Intergenic
1034957267 7:155342693-155342715 CCTTCTGTGAGCCTGGAAGAGGG + Intergenic
1035272694 7:157729799-157729821 CCTGCTGGCCACGTGGAGGACGG + Intronic
1035376383 7:158409614-158409636 CCTTTGGTTCACATAGAGGAGGG - Intronic
1035466114 7:159079028-159079050 CCTTCAGTGTCCATGGAGGAAGG + Intronic
1035917522 8:3641290-3641312 CCTCCTGTGCAGGTGGAGAACGG + Intronic
1036085861 8:5611974-5611996 CCTTCATGGCACCTGGAGGATGG - Intergenic
1036719357 8:11158699-11158721 CTGTCTGTGCACATGCTGGAGGG - Intronic
1037302940 8:17472028-17472050 CCTACTGTGCCCATGGAAAATGG + Intergenic
1040439811 8:47429363-47429385 CGTGCTGTGCACACGGAGGTGGG - Intronic
1042216717 8:66435447-66435469 CCAGCTGTGAAGATGGAGGAAGG - Intronic
1042847880 8:73186469-73186491 CCTTGCGTGTACAAGGAGGAAGG + Intergenic
1043510695 8:80947399-80947421 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
1044087569 8:87958995-87959017 CCTTCAGTCCACAGGGAGAAAGG + Intergenic
1044564310 8:93646937-93646959 CCTTCTGTGCACGTTCAGGTTGG - Intergenic
1046114258 8:109766029-109766051 GAGTCTGTGCACCTGGAGGAGGG - Intergenic
1047145629 8:122195905-122195927 CCTTATGGGCACATGAGGGATGG + Intergenic
1047850735 8:128854425-128854447 GCTTCTGTGCACACAGAAGAAGG + Intergenic
1047974097 8:130112362-130112384 CCCTCTGTACACATGAAGGGTGG - Intronic
1049632661 8:143666978-143667000 ATGTATGTGCACATGGAGGAAGG - Intergenic
1051020313 9:12534960-12534982 ACTTCTGTGCACCTGCAGGCTGG + Intergenic
1051400474 9:16676182-16676204 TCTTTTGTGTACATGTAGGAGGG + Intronic
1051667756 9:19481377-19481399 TCATCTGTGCACATGGAGGTGGG + Intergenic
1052795332 9:32918777-32918799 CCACCTGTGCACTGGGAGGACGG + Intergenic
1053062904 9:35045336-35045358 CCATGTGTACACATGGAGGCTGG + Exonic
1054734122 9:68733219-68733241 CCGTCTGTACACATGCAGTATGG + Intronic
1055661546 9:78508705-78508727 TCTCCTGACCACATGGAGGAAGG - Intergenic
1056515613 9:87346413-87346435 CCGTCTGGGGACATGCAGGAGGG - Intergenic
1057774271 9:97993247-97993269 CCTTCTCTGTAAATGGGGGAAGG + Intronic
1058086287 9:100752047-100752069 GAATCTGTGCACTTGGAGGAGGG - Intergenic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1059343500 9:113612914-113612936 CCTTCTGTCCCCAGGCAGGAAGG - Intergenic
1060293115 9:122322693-122322715 TCTTCTGTGTAGATGGGGGAGGG - Exonic
1060462042 9:123865485-123865507 CATTCTGCACACATGGTGGAGGG - Intronic
1060706492 9:125806492-125806514 CTGTCTGTTCACATGGTGGAAGG + Intronic
1062373171 9:136250745-136250767 CTTCCTGTGCACATGGTGAATGG + Intergenic
1062386523 9:136313904-136313926 CCCCCTGTAGACATGGAGGAAGG - Intergenic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1189789916 X:44593388-44593410 CTTTGTTTGCACATGGTGGAAGG + Intergenic
1190537131 X:51440569-51440591 GAATCTGTGCACTTGGAGGAGGG + Intergenic
1191189984 X:57656261-57656283 CAATCTGTGCACTGGGAGGATGG + Intergenic
1191891008 X:65940873-65940895 TCTTCTGTGCATGTGGAGAAAGG + Intergenic
1194334542 X:92629476-92629498 CCTTTTGTACACATTGAGGTGGG + Intergenic
1196217704 X:113072687-113072709 GATTCTGTGCACTTGGTGGAGGG - Intergenic
1196265882 X:113646091-113646113 CCTACTGTGGAGGTGGAGGAGGG + Intergenic
1196270188 X:113700470-113700492 GAATCCGTGCACATGGAGGAGGG - Intergenic
1197299421 X:124760050-124760072 CCACCTGTGCACTGGGAGGAAGG + Intronic
1199347686 X:146761140-146761162 CCTTCTGTGCCCCTAGAGGCAGG + Intergenic
1199854810 X:151751676-151751698 CCTTCCTTGCTCCTGGAGGATGG + Intergenic
1199858779 X:151781097-151781119 CCTTCTTGGCTCTTGGAGGAGGG + Intergenic
1200041717 X:153375682-153375704 GCTTCTGTGCACACAAAGGAGGG + Intergenic
1200127839 X:153825182-153825204 CCCTCTGTCCACATCGAGGGAGG - Intronic
1200643020 Y:5746530-5746552 CCTTTTGTACACATTGAGGTGGG + Intergenic