ID: 915838539

View in Genome Browser
Species Human (GRCh38)
Location 1:159197380-159197402
Sequence CACCTGCGCCTGCACTTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915838539_915838542 28 Left 915838539 1:159197380-159197402 CCTCTCAAGTGCAGGCGCAGGTG 0: 1
1: 0
2: 0
3: 13
4: 115
Right 915838542 1:159197431-159197453 GAGTTGCTTCTCCTAAGACTAGG 0: 1
1: 0
2: 1
3: 9
4: 125
915838539_915838540 -4 Left 915838539 1:159197380-159197402 CCTCTCAAGTGCAGGCGCAGGTG 0: 1
1: 0
2: 0
3: 13
4: 115
Right 915838540 1:159197399-159197421 GGTGCATTTCCTTCTCTAACTGG 0: 1
1: 0
2: 0
3: 17
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915838539 Original CRISPR CACCTGCGCCTGCACTTGAG AGG (reversed) Intronic
900292111 1:1928070-1928092 CTCCTGGGCGTGCACTCGAGGGG - Intronic
900340386 1:2186003-2186025 CAGCTGTGCCTTCACCTGAGGGG - Intronic
901393930 1:8966796-8966818 CACCTGCTCCTGCTCTAGAGAGG - Intronic
901829511 1:11883540-11883562 CACCTGTGCCCGCACGTGAGTGG + Intergenic
901948032 1:12719277-12719299 CACCTGGGCCTGCATGGGAGTGG + Intronic
903590454 1:24451755-24451777 CCACTGTGCCTGCATTTGAGGGG - Intronic
903912003 1:26734439-26734461 CACCTTCACCTTCACTTCAGTGG - Intronic
912656426 1:111489981-111490003 AACCTGAGCCTGCATTTTAGTGG - Intronic
913231165 1:116741861-116741883 CACCTGCGCCTGCGCCTGCGAGG + Intergenic
915838539 1:159197380-159197402 CACCTGCGCCTGCACTTGAGAGG - Intronic
922420071 1:225453708-225453730 CACCTGGCCCTGCCCTTGACAGG + Intergenic
922898492 1:229118784-229118806 CACCTGAGCTTGAAGTTGAGAGG - Intergenic
924262072 1:242242271-242242293 CACCTGCGCCTGCAATCCAGGGG + Intronic
924474167 1:244368701-244368723 CACCTGAGCCTGCCCTTGTGTGG + Intronic
1064506049 10:16031274-16031296 CACCTGCACCTGAAATTGACAGG + Intergenic
1069731950 10:70622776-70622798 CACCAGCTCCTGCACCTGGGAGG - Intergenic
1070304716 10:75233526-75233548 CACCAGGGCCTCCACTGGAGAGG + Intergenic
1074778945 10:116786393-116786415 CACCTGTGCCTCTACCTGAGGGG - Intergenic
1075064117 10:119277983-119278005 CACCTGCGCAAACAGTTGAGTGG - Intronic
1076410317 10:130244600-130244622 CACCTGCCCCTGCTCTTGACAGG + Intergenic
1078405625 11:11067834-11067856 CACCTGCTCCTCCAAGTGAGGGG + Intergenic
1079885039 11:25977011-25977033 CACCTGTGCCAACACTTAAGTGG - Intergenic
1080385923 11:31811243-31811265 CTCCTGCGCCTGAACCAGAGCGG + Intronic
1084014706 11:66371638-66371660 CACCTGCACCTGCGCTGGGGCGG + Exonic
1084297837 11:68224729-68224751 GAGCTGCTCCTGCACCTGAGTGG - Intergenic
1089252135 11:117172133-117172155 CACCAGCATCTGTACTTGAGGGG + Intronic
1090807931 11:130214102-130214124 CACCTGCAACTGCACGTTAGGGG + Intergenic
1098251494 12:68574523-68574545 CATCTGTGCTTGGACTTGAGGGG - Intergenic
1103578932 12:121899862-121899884 CCCCTGGGCATGGACTTGAGTGG - Intronic
1103963263 12:124622479-124622501 CACCTGCACCTGCACCTGCTAGG + Intergenic
1104008354 12:124911724-124911746 CACTTGGTCCTGCGCTTGAGGGG - Exonic
1104118336 12:125772457-125772479 CACCTGCCCATGCAGCTGAGCGG + Intergenic
1104672833 12:130692234-130692256 CACCTTCACCTGCACGTGGGGGG + Intronic
1105424830 13:20285188-20285210 GACCTCCTCCTGGACTTGAGTGG + Intergenic
1106499038 13:30309426-30309448 CACCTGGCCCTGCCCTTGACAGG - Intergenic
1111364147 13:87219237-87219259 CACCTGGTCCTGCATCTGAGGGG + Intergenic
1113444697 13:110356370-110356392 CACTTGCGACTTCATTTGAGGGG - Intronic
1120996838 14:90423775-90423797 CACCAGCCCCTGCCCTTAAGGGG - Intergenic
1121300976 14:92870722-92870744 CACCTGGCCCTGCCCTTGACAGG + Intergenic
1121301175 14:92872503-92872525 CACCTGGCCCTGCCCTTGACAGG + Intergenic
1121301309 14:92873653-92873675 CACCTGGCCCTGCCCTTGACAGG + Intergenic
1121722303 14:96118060-96118082 CTCATGCGCCAGCACTTGGGAGG + Intergenic
1122148447 14:99708209-99708231 CACCAGCGCCTGCCACTGAGAGG + Intronic
1122148473 14:99708320-99708342 CACCAGCGCCTGCCACTGAGAGG + Intronic
1122148500 14:99708431-99708453 CACCAGCGCCTGCCACTGAGAGG + Intronic
1122148527 14:99708542-99708564 CACTAGCGCCTGCCATTGAGAGG + Intronic
1123579504 15:21703627-21703649 CATCTGAGCCTGCTCTTCAGTGG - Intergenic
1123616131 15:22146138-22146160 CATCTGAGCCTGCTCTTCAGTGG - Intergenic
1125722439 15:41851720-41851742 CACTTGCAGCAGCACTTGAGTGG - Intronic
1126185852 15:45829805-45829827 CAGCTGCAGCTGCACCTGAGAGG + Intergenic
1127811874 15:62572194-62572216 CCCCTGTGCCTGCCCTTGGGAGG + Intronic
1130580724 15:85134961-85134983 CACCAGCTCCGGCACTTGCGTGG - Intronic
1130695610 15:86128363-86128385 CACCTGGCCCTGCCCTTGACAGG + Intergenic
1132110799 15:99100572-99100594 CCCCTGAGCCTTCGCTTGAGCGG - Intronic
1202988374 15_KI270727v1_random:437872-437894 CATCTGAGCCTGCTCTTCAGTGG - Intergenic
1144568899 17:16382565-16382587 CACCTGGTCCTGCGCCTGAGGGG + Exonic
1145360127 17:22204977-22204999 CACCTGGTCCTGCGCCTGAGGGG + Exonic
1148465976 17:47865526-47865548 CACCTGTTCCTGCTGTTGAGGGG + Intergenic
1152558632 17:81067056-81067078 CAGCGGCGCCTGCAGATGAGAGG + Intronic
1156719890 18:40057435-40057457 CACCTGGTCCTGCCCTTGACAGG - Intergenic
1158198753 18:54916811-54916833 CACCTGGCCCTGCCCTTGACAGG - Intronic
1160005184 18:75063921-75063943 CACCTGTGCCCGCTCCTGAGAGG - Exonic
1163640833 19:18461139-18461161 CACCTGCGCCTCCGGGTGAGGGG - Intronic
1163720792 19:18897259-18897281 CACCTGCACCTGAACTTCAGGGG + Intergenic
1164905734 19:31966494-31966516 CTCCTGTGACTGCAATTGAGAGG - Intergenic
1166039458 19:40192752-40192774 CACCTAGGCCTGGCCTTGAGAGG - Intronic
927680403 2:25135403-25135425 CATCTCCTCCTGCACCTGAGAGG + Intronic
931051709 2:58423075-58423097 CAGCTGCTGCTGTACTTGAGGGG - Intergenic
931429071 2:62195639-62195661 CACCCGCCCCAGCACTGGAGGGG + Intergenic
933383252 2:81578125-81578147 CACCTGCTTCTGCACTTGGAAGG - Intergenic
934014621 2:87866696-87866718 CACCTGTGTCTGCACATGTGGGG + Intergenic
937087633 2:119181805-119181827 CACCTGGGCCCCCACCTGAGCGG + Intergenic
938959605 2:136329451-136329473 CACCTGGTCCTGCACCTGAGGGG - Intergenic
942688065 2:178555037-178555059 AACCTGCGCCTACTATTGAGTGG - Exonic
947914864 2:233824551-233824573 CACCTGCGCCTGGCCCTGTGTGG - Intronic
948420804 2:237859197-237859219 CCCCAGCGCCTGCACCTGGGCGG + Intronic
1169207423 20:3748307-3748329 CACCAGCTCCTGGACCTGAGTGG + Exonic
1172702792 20:36863264-36863286 CACCCGCGCCTGCCCCGGAGAGG - Exonic
1175613704 20:60374108-60374130 CACCTGGCCCTGCCCTTGACAGG - Intergenic
1175916895 20:62430244-62430266 CACCCCCACCTGCACCTGAGGGG + Intergenic
1179789619 21:43748872-43748894 CCCCTGAGCCTGGACTTCAGGGG + Intronic
1181458323 22:23071690-23071712 CCCCTGCACCTGCACTCAAGCGG - Intronic
1181684716 22:24520441-24520463 CACCTGCGCCATCAATCGAGTGG + Exonic
1183100894 22:35583455-35583477 CACCTGCGTCTGCCCCTGACTGG - Intergenic
953789448 3:45936368-45936390 CCCCAGCGCCGGCACTGGAGAGG + Intronic
960054308 3:113265829-113265851 AACCTGCCTCTGCACTTGATGGG - Intronic
964569752 3:158098270-158098292 CAGCTGCGCCTGAACCTGAAAGG + Exonic
968321626 3:197774141-197774163 CAACTGGGCCTGCACCTGAAGGG - Exonic
969452630 4:7283618-7283640 GACCTGTGCCTGCCCTTGTGGGG + Intronic
970121780 4:12761986-12762008 CACCTGGGCCTGCCTTTGACAGG + Intergenic
974233551 4:59149457-59149479 CACCTGGGCCTGCAGTTCAGAGG - Intergenic
977788962 4:101075130-101075152 CACCTGGCCCTGCCCTTGACAGG + Intronic
979250579 4:118562852-118562874 CACCTGGTCCTGCCCTTGACAGG - Intergenic
986266222 5:6193533-6193555 CACCTGCTCCAGCACCTGTGTGG - Intergenic
997749277 5:136328952-136328974 TCCAGGCGCCTGCACTTGAGGGG - Intronic
999443609 5:151621435-151621457 CACCTGTCACTGCCCTTGAGGGG - Intergenic
1003478193 6:6504763-6504785 CATCTGAGCCTCCTCTTGAGAGG - Intergenic
1011640002 6:89409837-89409859 CACCTGGGCCTGCAGTGGATAGG - Intronic
1017079543 6:150654483-150654505 CTCCTGCACCTGCTCATGAGAGG - Intronic
1020996940 7:15277813-15277835 CACCTGGGCCTGCACTGAACAGG - Intronic
1021607065 7:22418764-22418786 CAGCTGCCTCAGCACTTGAGTGG + Intergenic
1021942306 7:25689736-25689758 CACCTGGGGCTGCACCTGTGAGG - Intergenic
1022598934 7:31738495-31738517 CACCTGGCCCTGCTCTTGACAGG + Intergenic
1023018182 7:35986276-35986298 CCCCCACCCCTGCACTTGAGAGG - Intergenic
1024038947 7:45534530-45534552 CAGTTGGTCCTGCACTTGAGGGG - Intergenic
1029714882 7:102320331-102320353 CACCTGCGCCTGTCCCTGAACGG + Exonic
1032405433 7:131652386-131652408 CACCTGCTCCTGGCCTTGGGGGG - Intergenic
1034760960 7:153671474-153671496 CACCTGGTCCTGCCCTTGACAGG - Intergenic
1034835914 7:154351531-154351553 CACCTGCACCTGCACCTGGAGGG + Intronic
1035675867 8:1455232-1455254 CACCTGCACCTGCACCTGACTGG - Intergenic
1035917304 8:3638617-3638639 CACCTGCTCCTCCACATGACTGG - Intronic
1038070385 8:24006596-24006618 CACCTGGTCCTGCCCTTGACAGG - Intergenic
1038415274 8:27390298-27390320 CACCTGATCCTGCACTTAGGAGG + Intronic
1039579385 8:38651280-38651302 CTCCTGCGCCTGCCCTGTAGGGG - Intergenic
1046163590 8:110398853-110398875 CACCTGGTCCTGCCCTTGACAGG - Intergenic
1048461365 8:134624152-134624174 CACATGTGCCTGCACGTTAGGGG - Intronic
1049198782 8:141329782-141329804 CACCTGCGCCTGGGCCTGTGAGG + Intergenic
1049751952 8:144289092-144289114 CACCTGCACCTGCTCCTCAGTGG + Exonic
1056109863 9:83384349-83384371 CAGCTGCTCCTGCCATTGAGAGG - Intronic
1057229145 9:93308379-93308401 CACCTGCGCCTGGACGTGCAGGG - Exonic
1059830309 9:118087780-118087802 CACCTGGCCCTGCCCTTGACAGG - Intergenic
1060525148 9:124316217-124316239 CACCAGCCCCCGCACTTGAGAGG - Intronic
1060734505 9:126058249-126058271 CTCCTGCGCCTCCATTTGAGTGG - Intergenic
1061481819 9:130901297-130901319 CTCCTGCTGCTTCACTTGAGGGG - Intergenic
1062383022 9:136296673-136296695 CAGCGGCCCCTGCCCTTGAGCGG - Intronic
1187118106 X:16374219-16374241 CTCCTGAGCCAGCACTTTAGGGG + Intergenic
1197767129 X:130066623-130066645 CACCTGCCCCTGCATTTCAGTGG - Exonic
1199129857 X:144171815-144171837 CACCTGTGTCTGCACATGTGGGG - Intergenic
1201379919 Y:13363903-13363925 CAGCTTCTCCTGAACTTGAGTGG + Intronic