ID: 915839828

View in Genome Browser
Species Human (GRCh38)
Location 1:159204968-159204990
Sequence CTGTCTGCACAGGGTGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 191}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915839817_915839828 19 Left 915839817 1:159204926-159204948 CCCTTCTGTCTGCGGGCCTGAAC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 915839828 1:159204968-159204990 CTGTCTGCACAGGGTGAGTATGG 0: 1
1: 0
2: 0
3: 12
4: 191
915839815_915839828 24 Left 915839815 1:159204921-159204943 CCCAGCCCTTCTGTCTGCGGGCC 0: 1
1: 0
2: 1
3: 16
4: 456
Right 915839828 1:159204968-159204990 CTGTCTGCACAGGGTGAGTATGG 0: 1
1: 0
2: 0
3: 12
4: 191
915839824_915839828 -3 Left 915839824 1:159204948-159204970 CCAAACGGTGCCATGGGGAACTG 0: 1
1: 0
2: 0
3: 7
4: 69
Right 915839828 1:159204968-159204990 CTGTCTGCACAGGGTGAGTATGG 0: 1
1: 0
2: 0
3: 12
4: 191
915839821_915839828 3 Left 915839821 1:159204942-159204964 CCTGAACCAAACGGTGCCATGGG 0: 1
1: 0
2: 0
3: 5
4: 57
Right 915839828 1:159204968-159204990 CTGTCTGCACAGGGTGAGTATGG 0: 1
1: 0
2: 0
3: 12
4: 191
915839818_915839828 18 Left 915839818 1:159204927-159204949 CCTTCTGTCTGCGGGCCTGAACC 0: 1
1: 0
2: 0
3: 10
4: 89
Right 915839828 1:159204968-159204990 CTGTCTGCACAGGGTGAGTATGG 0: 1
1: 0
2: 0
3: 12
4: 191
915839812_915839828 28 Left 915839812 1:159204917-159204939 CCGTCCCAGCCCTTCTGTCTGCG 0: 1
1: 0
2: 4
3: 51
4: 316
Right 915839828 1:159204968-159204990 CTGTCTGCACAGGGTGAGTATGG 0: 1
1: 0
2: 0
3: 12
4: 191
915839816_915839828 23 Left 915839816 1:159204922-159204944 CCAGCCCTTCTGTCTGCGGGCCT 0: 1
1: 0
2: 2
3: 16
4: 283
Right 915839828 1:159204968-159204990 CTGTCTGCACAGGGTGAGTATGG 0: 1
1: 0
2: 0
3: 12
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915839828 Original CRISPR CTGTCTGCACAGGGTGAGTA TGG Intronic
901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG + Intronic
902521477 1:17020189-17020211 CGGTCCCCACAGGGTCAGTAAGG + Intronic
903268571 1:22173766-22173788 CTGTCTGCAGAGGGGCAGGAAGG - Intergenic
903791195 1:25894235-25894257 CAGTCTGCACACTGTGAGCAGGG + Intronic
907057383 1:51382875-51382897 CTGGCTTCACAGAATGAGTATGG - Intronic
912748657 1:112267414-112267436 CTGTCTGCAGAGGGTGAACCTGG + Intergenic
915839828 1:159204968-159204990 CTGTCTGCACAGGGTGAGTATGG + Intronic
916516773 1:165525797-165525819 CTGTTTGCACAAGCTGAGTGTGG - Intergenic
917120818 1:171643223-171643245 TTGCCTGCACAGGGGGAGAAGGG - Intronic
917788924 1:178487176-178487198 CTGTCTGCACTGGGTGGGCAAGG - Intergenic
920421868 1:205840260-205840282 CTGTCTGTCCAGGGTGAATCCGG + Exonic
920697226 1:208190244-208190266 CTCTCTGCACAAGGTCAGAAAGG - Intronic
1063238369 10:4142523-4142545 CAGACTGCACAGGGTGGGTAAGG - Intergenic
1065341728 10:24713093-24713115 CAGTCTCCACATTGTGAGTAAGG + Intronic
1065969895 10:30798055-30798077 CTCTCTGAGCAGGGTGAGTTTGG - Intergenic
1067904382 10:50275586-50275608 CAGTCTGCACTGGGTGGGTATGG - Intergenic
1071487766 10:86114128-86114150 CTCTCTGCACAGGGTGGGGCGGG + Intronic
1075179346 10:120196118-120196140 GTGTGTGCACAGGGTGATGATGG + Intergenic
1077390416 11:2298470-2298492 TTGTCTGCACAGGGAGTGTGGGG + Intronic
1080075039 11:28139025-28139047 CGGTCTGCACAGGGAGAGGGAGG + Intronic
1080373868 11:31684862-31684884 CTGTCTTCACAGGGAGTGTCTGG + Intronic
1081853040 11:46286988-46287010 CTGTCTGCACACGTTGAGCCTGG - Intronic
1082004735 11:47413337-47413359 CTGTCTGCCCTGGCTGAGTGGGG + Intronic
1083365785 11:62140795-62140817 CTGGCTGGGCAGGGTGAGGAAGG - Exonic
1083690139 11:64402944-64402966 CTGTGTGCACAAGGAGAGTGAGG - Intergenic
1083956186 11:65984176-65984198 CAGGCTGGTCAGGGTGAGTAGGG + Intergenic
1084783782 11:71429847-71429869 GGGTTTGCACAGGGTGAGTGTGG - Intronic
1085284300 11:75350156-75350178 CTCTCTCCACAGTGTGAGAAAGG - Intronic
1086478795 11:87210651-87210673 CTGGCTTCACAGAGTGAGTTAGG - Intronic
1089128770 11:116195591-116195613 CTGACTGCATAGGCTGAATAAGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091304386 11:134528187-134528209 CTGTCTGCTCTGGGTGTGTGAGG + Intergenic
1096786617 12:54020428-54020450 CTGTCAGACCAGGGTGAGAAAGG - Intronic
1104068659 12:125326658-125326680 CTGTCTGCACCGGGGGAGGTCGG + Exonic
1104716098 12:131017273-131017295 CTGTGTGCACTGGGTGTGTGTGG - Intronic
1104716104 12:131017312-131017334 CTGTGTGCACTGGGTGTGTGTGG - Intronic
1104716110 12:131017351-131017373 CTGTGTGCACTGGGTGTGTGTGG - Intronic
1105240680 13:18607121-18607143 CTGTCTTCATAGAATGAGTATGG - Intergenic
1107098298 13:36560315-36560337 CTGTCTGCACAGTGTGAAGGAGG - Intergenic
1108194382 13:47977417-47977439 CTGGCTTCATAGAGTGAGTATGG - Intronic
1108276974 13:48820929-48820951 GTGCCTGCACAGAGTGAGTGAGG + Intergenic
1112236173 13:97639365-97639387 TTGTCTGCACAGTGTGAAAATGG - Intergenic
1112248080 13:97752837-97752859 GTGTCTTCACAGGGTGAAAAGGG - Intergenic
1113598277 13:111549402-111549424 CTGTCTCCACAGGGTGATCCTGG - Intergenic
1116332239 14:43611679-43611701 ATCTCTGCACAGGATAAGTAGGG + Intergenic
1119574488 14:75706468-75706490 CTGTATGCAAAGAGTGAATAAGG - Intronic
1120368241 14:83598020-83598042 CAGACTGGGCAGGGTGAGTAGGG + Intergenic
1121030808 14:90657164-90657186 CTCCCTGCACTGGGTGAGTAGGG - Exonic
1122122056 14:99560036-99560058 CTGTGTGCAGGGGGTGAGTGGGG - Intronic
1122353139 14:101109033-101109055 CTGGCTGACCAGGGTGAGGATGG - Intergenic
1122831664 14:104400552-104400574 TGGGCAGCACAGGGTGAGTATGG - Intergenic
1122924934 14:104895132-104895154 GGGGCTGGACAGGGTGAGTAGGG - Exonic
1125383818 15:39115293-39115315 CTATCTGCACAGGAGGGGTATGG - Intergenic
1125828099 15:42692800-42692822 CTGGAGGCACAGGGTGGGTAAGG - Exonic
1127259860 15:57319776-57319798 GTGGCTGGTCAGGGTGAGTAGGG + Intergenic
1127587361 15:60391334-60391356 CTGTCTGCCTAGGCTGAGAAGGG + Intronic
1128335128 15:66780896-66780918 CTGTCTGCACAGTGGGAGCTGGG - Intronic
1129045820 15:72733115-72733137 CAGTCTCCCCAGGGTCAGTAAGG + Intronic
1129451277 15:75652552-75652574 CTCTCTGCCCAGGGTCAGAAAGG - Intronic
1131089990 15:89616824-89616846 CTGTCAGCAAAGGCTGAGTTGGG - Intronic
1132399517 15:101496810-101496832 CTGTCAGCTGAGGGTGAGTATGG - Intronic
1132806004 16:1775417-1775439 CTGTCTGAGCTGGGTGAGTCAGG + Intronic
1132975844 16:2710758-2710780 CTGTGTGCACATGGTGTGTGTGG + Intergenic
1135336275 16:21604048-21604070 CTGCCTCCACAGGGTAAGTGAGG - Intronic
1135664801 16:24326725-24326747 CTCTCTGCACAGGCTGAAGAGGG + Intronic
1136519303 16:30786053-30786075 CTGTGTGCACAGGGGCAGTGGGG + Intronic
1137243980 16:46688199-46688221 CTATCTACACAGAGTGAGTAAGG + Intronic
1137362534 16:47832044-47832066 GTGGCAGAACAGGGTGAGTAAGG + Intergenic
1138916728 16:61473289-61473311 CTGACTTCACAGAATGAGTACGG - Intergenic
1139469072 16:67168819-67168841 CTGTCTGCACAGGGGGCCTCTGG + Exonic
1139966366 16:70747709-70747731 CTGTCTGCACAGGGGGACAGAGG + Intronic
1140831324 16:78754192-78754214 CTGTCTTCACTCGGTGAGGATGG + Intronic
1141273873 16:82566820-82566842 CTGTCTACACAGAGAAAGTATGG - Intergenic
1141427740 16:83954775-83954797 CTGCCTGCAAAGGGTGGGAAGGG + Intronic
1141472621 16:84249824-84249846 CTGTCTGCCCTGGGTGAGGCTGG + Intergenic
1143457365 17:7076882-7076904 CTGACTTCCCAGGGTGAGTCTGG - Exonic
1143564445 17:7713032-7713054 CTGGGAGGACAGGGTGAGTAAGG + Intergenic
1143933753 17:10460322-10460344 CTGTGTGAACAAGGTGAGAATGG + Intronic
1145769902 17:27485442-27485464 CTGTCTGCAGAGGGCCAGTCAGG - Intronic
1146041130 17:29455968-29455990 CTGGCTTCATAGGGTGAGTTAGG + Intronic
1146478526 17:33182778-33182800 CACTCTGCACAGTGTGAGTTAGG + Intronic
1147524613 17:41209954-41209976 TTGTCAGCACAGGTTGAATAGGG - Intronic
1148343464 17:46887956-46887978 TTGGCTGCCCAGGGTGAGTAGGG - Intergenic
1149426985 17:56564765-56564787 TCTTCTGCACAGGCTGAGTAGGG - Intergenic
1150243235 17:63652865-63652887 CTATCTGCACTGAATGAGTAGGG - Intronic
1152596206 17:81238976-81238998 CTTTCTACACCGGGTGAGTGAGG - Exonic
1154448200 18:14451968-14451990 CTGTCTTCATAGAATGAGTATGG + Intergenic
1156327402 18:36086402-36086424 ATGTCTGCTAAGGGTGAGTCAGG - Intergenic
1159888956 18:73936623-73936645 CTGTGTGCACATGGTGACTGAGG + Intergenic
1160766493 19:810986-811008 CTGTCACCGCAGGGTGAGCAAGG - Exonic
1162453224 19:10767046-10767068 CTGTCTGCAGAGGGTGGCTGTGG + Intronic
1163248656 19:16112569-16112591 CAGTCTGCACGTGGTGAGAATGG + Intronic
1163692555 19:18745461-18745483 CTGTCTGCACCTGGTGAGACTGG + Intronic
1163737462 19:18990260-18990282 CTGCCTGACCAGGGTGAGGAGGG - Intergenic
1167307380 19:48716857-48716879 CCGCCTGCACAGGCTGTGTAAGG - Intronic
1167487243 19:49769832-49769854 CTGGCTTAACAGGGTGAGAAGGG + Intronic
928459335 2:31456248-31456270 CAGTTTGCACAGGGAGAGGAAGG + Intergenic
929943557 2:46353214-46353236 CTGCCAGCACAGGGTAATTAAGG + Intronic
935235323 2:101133589-101133611 GTGTCTTCACAAGGTGGGTAGGG + Intronic
938638696 2:133256948-133256970 CAGTCTGTAGAGGGTAAGTAGGG - Intronic
938657091 2:133445704-133445726 TTGGCAGCACAGGGAGAGTAAGG + Intronic
939831290 2:147074697-147074719 CTGGCTTCATAGAGTGAGTAAGG + Intergenic
941844745 2:170121583-170121605 CTGTCCTCATAGGGTGAATAGGG + Intergenic
946768290 2:223060618-223060640 CTCTCTGCACTGGGGGAGGAGGG - Intronic
946815898 2:223578241-223578263 GTGTATGCACAAGGTGAGAAAGG + Intergenic
948679542 2:239624052-239624074 CTGGCTTCACAGGATGAGTTAGG + Intergenic
1169110642 20:3031050-3031072 CTGTCTGCCCAGGCTGATGATGG - Intronic
1169597526 20:7217836-7217858 CTGTCACCCCAGGGTGACTATGG - Intergenic
1171274562 20:23845122-23845144 GTCTCTGCACAGGAAGAGTAAGG - Intergenic
1173847004 20:46194477-46194499 CTGTCTCCCCAGGTTGGGTATGG + Intronic
1174717092 20:52770896-52770918 CTGTCATCAGAGGCTGAGTAGGG + Intergenic
1175301225 20:57943968-57943990 CTGTCTGAACAGGGTTACCAAGG - Intergenic
1175755321 20:61525912-61525934 CTGTCCCCACAGGGTCAGTGGGG - Intronic
1175766525 20:61596393-61596415 CTTTCTGCACACGATGAGTTGGG - Intronic
1178296893 21:31417720-31417742 CTGACTGCACAGGTAGAGTGTGG - Intronic
1178576941 21:33801787-33801809 CTTTCTGTAAAGGATGAGTAAGG - Intronic
1180971059 22:19815974-19815996 CTGTGTGCACAGGGCTAGGAGGG - Intronic
1182196438 22:28523438-28523460 ATGACTGCCCAGAGTGAGTATGG - Intronic
1182351257 22:29701221-29701243 CTGTCTTCACAGGGGGTGGAAGG - Intergenic
950220707 3:11193561-11193583 CTGTCTTCACATGGTGGGAAGGG + Intronic
957459279 3:80496627-80496649 ATGTCTGCAAAGGGTGAGCCAGG + Intergenic
961190068 3:124952658-124952680 ATGTGTTCACAGGGGGAGTAGGG + Intronic
962215237 3:133515294-133515316 CTGGCAGCACAGGGTGAGTGTGG - Intergenic
962317109 3:134365807-134365829 CTGCTTGCTCAGAGTGAGTAGGG - Exonic
963251340 3:143105870-143105892 CAGTTTGCACAGGGAGAGAAAGG - Intergenic
963973869 3:151459523-151459545 ATGCCTGCACAGGGTCAGCATGG - Intergenic
966707110 3:182928231-182928253 CTGTCTTCACAGAATGAGTTTGG - Intergenic
969688452 4:8689967-8689989 CTGGCTGCACAGGTGGAGTCTGG + Intergenic
972397775 4:38672455-38672477 CTGGCTGCACAGAGTGGGGAGGG + Intronic
974247818 4:59343990-59344012 CTGTTTGCACAAAGTGACTAAGG + Intergenic
974807895 4:66905015-66905037 CTGTCTGAGCCAGGTGAGTAGGG - Intergenic
975424377 4:74209137-74209159 CAGTTTGCACAGGGAGAGTGAGG + Intronic
977608168 4:99003919-99003941 GTGTCTGAACAGGGTGGGAAAGG - Intronic
977753975 4:100643744-100643766 CTTTCTGCACAGGTTGACTCAGG - Intronic
981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG + Intergenic
985074880 4:186204481-186204503 CTTACTGCACAGGGTGTGGAGGG + Intronic
986540939 5:8843199-8843221 CTATCTGCACAGAGTGAACATGG + Intergenic
987284222 5:16439876-16439898 ATGTCTGTACATGTTGAGTATGG + Intergenic
987810993 5:22836026-22836048 ATGTCTGCATAGGAAGAGTATGG + Intronic
988069369 5:26267014-26267036 TTTTCTGCACAGGATGAGTAGGG + Intergenic
988375865 5:30435053-30435075 ATGTCTGCACAAGTTTAGTAAGG + Intergenic
988607977 5:32697495-32697517 CTGGCTGCATAGAGTGAGTTTGG + Intronic
988646909 5:33105021-33105043 ATCTCTGCACAGGAAGAGTAGGG + Intergenic
989213435 5:38880067-38880089 CAGTCTGCAGAGAGTGAGAAAGG + Intronic
990725811 5:58753631-58753653 CTGTCTTCACAGGAAGAGGAGGG + Intronic
991743350 5:69706440-69706462 CTGGCTTCACAGCGTGAGTTAGG - Intergenic
991754349 5:69848763-69848785 CTGGCTTCACAGCGTGAGTTAGG + Intergenic
991794923 5:70286176-70286198 CTGGCTTCACAGCGTGAGTTAGG - Intergenic
991803968 5:70405514-70405536 CTGGCTTCACAGCGTGAGTTAGG + Intergenic
991822734 5:70581751-70581773 CTGGCTTCACAGCGTGAGTTAGG - Intergenic
991833674 5:70723911-70723933 CTGGCTTCACAGCGTGAGTTAGG + Intergenic
991887297 5:71285714-71285736 CTGGCTTCACAGCGTGAGTTAGG - Intergenic
993028327 5:82672262-82672284 CTGTCTGAGCAAGGTGGGTAGGG - Intergenic
994273250 5:97807142-97807164 CTGTTTGCACAGGGAGAGGGAGG + Intergenic
994282406 5:97921445-97921467 CTATCTTCACAGGGTGAGAAGGG - Intergenic
994796981 5:104316336-104316358 CTGTCTTCACAGAGATAGTATGG + Intergenic
995901687 5:117076584-117076606 CTCTCTGGACAGGGTTAGCAGGG - Intergenic
996889686 5:128403449-128403471 TTGTGTACACAGGGTGAGAAAGG - Intronic
997487669 5:134245358-134245380 CTGTATGCACAGTGTCAGCAAGG + Intergenic
1003168728 6:3703703-3703725 CTGTCAGCACAGGGTCAGGCAGG - Intergenic
1006451172 6:34106551-34106573 GTGGCTGGACAGGGTGAGTGAGG - Intronic
1009500940 6:64413110-64413132 ATGGCTGCACAAGGTGAGGAAGG - Intronic
1013009085 6:106103938-106103960 CTGTCTGCACATCGCGAGGAAGG + Intronic
1013255391 6:108379931-108379953 CTCTCTGCACAGGAAGAGTGGGG + Intronic
1014177639 6:118348150-118348172 CTGTCTGCCCACGCTGAGTGCGG + Intergenic
1016389547 6:143561237-143561259 CTGTCATCACAGGGTGAGGAGGG - Intronic
1017924157 6:158896361-158896383 CTGTCTGTACAGGATGGGTAAGG - Intronic
1020490373 7:8775418-8775440 CTGGCTTCACAGGATGAGTTGGG + Intergenic
1021622698 7:22564076-22564098 CTTTCTGCTCAGGGTGACTGTGG + Intronic
1021934148 7:25613767-25613789 CTGACATCACAGGGTAAGTATGG - Intergenic
1022636946 7:32144908-32144930 CTGTCTATCCAGGGAGAGTAAGG - Intronic
1023692422 7:42804827-42804849 CTGCCTGCCCAGGGTCAGTGAGG + Intergenic
1024324954 7:48102211-48102233 CTGTCTACACAGTGTGAGGGTGG + Intronic
1024535412 7:50426929-50426951 CTGTGTGTACAGGGTGAGATGGG - Intergenic
1030124773 7:106143470-106143492 CTGCCTGCACAGGTTTTGTAAGG - Intergenic
1030865581 7:114698502-114698524 CAGGCAGCACAGGGAGAGTAGGG - Intergenic
1031061991 7:117062090-117062112 GTGTCTTCACAGGGTGAGGGGGG + Intronic
1032084364 7:128876294-128876316 ATGTCTGCCCAGGGTGGGTGTGG + Intronic
1035929172 8:3762421-3762443 ATGTCTGCAAAGGGTAAGTCTGG - Intronic
1037939015 8:22936587-22936609 CTGGCTTCACAGAGTGAGTCAGG - Intronic
1038713874 8:29974331-29974353 CTGTCTGCCCAGGATGAATTTGG - Intergenic
1038779236 8:30556608-30556630 CTGTGTGCACTGGGTCAGTGTGG - Intronic
1040853446 8:51925262-51925284 CTGCCTGCACACTGGGAGTATGG - Intergenic
1043324879 8:79037546-79037568 CTGGCTGCATAGAATGAGTAAGG - Intergenic
1047415627 8:124662567-124662589 CTGTCTTCAGAGGGTGCGTCAGG - Intronic
1048229368 8:132621699-132621721 CTGTCTGCTGAGTGTGGGTAAGG + Intronic
1048281987 8:133112467-133112489 CTGTCTGCACTGTGGGAGTCTGG - Intronic
1048863773 8:138743832-138743854 CTGTCTGCCCATGGAGAGGAAGG + Intronic
1049779577 8:144422683-144422705 CTCTGTGCACAGGCTGAGTGGGG - Intergenic
1052707938 9:32015903-32015925 ATGCCTGCCAAGGGTGAGTAAGG + Intergenic
1055375445 9:75645002-75645024 CTGCCAGCACAGGGTAAGTTTGG + Intergenic
1057040145 9:91842067-91842089 GGGTCTGCACAGGGGCAGTATGG - Intronic
1057146025 9:92760118-92760140 CTGACTCCACAGGGGGAGTCTGG - Intronic
1057423155 9:94928058-94928080 CTTTCTGCACAGGATGGGGAAGG - Intronic
1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG + Exonic
1060740299 9:126093401-126093423 CTGGCTGCAGAGGGAGAGTGAGG + Intergenic
1062101611 9:134731477-134731499 CTGGCTGCAGAGGGAGAGGAAGG - Exonic
1185462251 X:338768-338790 CTCCCTGCTCAGGGTGAGTGCGG - Exonic
1186435782 X:9542298-9542320 GTGTCAGGACAGGGTGAGTGGGG - Intronic
1186810977 X:13188119-13188141 CTGTAGGTACAGGATGAGTACGG + Intergenic
1186892121 X:13969164-13969186 CTGGCAGCTCAGGGTGAATATGG + Intergenic
1189462542 X:41253907-41253929 CTGTCTGGGCAGGGTGGGTTCGG + Intergenic
1192213268 X:69141018-69141040 CTGCCTGAACTGGGTGAGCAAGG - Intergenic
1195919887 X:109973547-109973569 CTGTCAACAGAGGTTGAGTAGGG - Intergenic