ID: 915841976

View in Genome Browser
Species Human (GRCh38)
Location 1:159220982-159221004
Sequence GCTCCATTTGAACAGGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915841970_915841976 12 Left 915841970 1:159220947-159220969 CCATCAGTGGAATAACTTTATGT No data
Right 915841976 1:159220982-159221004 GCTCCATTTGAACAGGGTCAGGG No data
915841969_915841976 13 Left 915841969 1:159220946-159220968 CCCATCAGTGGAATAACTTTATG No data
Right 915841976 1:159220982-159221004 GCTCCATTTGAACAGGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915841976 Original CRISPR GCTCCATTTGAACAGGGTCA GGG Intergenic
No off target data available for this crispr