ID: 915849464

View in Genome Browser
Species Human (GRCh38)
Location 1:159305752-159305774
Sequence TCTGGGGCCACAAAGCCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 244}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915849464_915849467 -7 Left 915849464 1:159305752-159305774 CCGAGAGGCTTTGTGGCCCCAGA 0: 1
1: 0
2: 2
3: 14
4: 244
Right 915849467 1:159305768-159305790 CCCCAGACTGACTTTTCAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 135
915849464_915849472 0 Left 915849464 1:159305752-159305774 CCGAGAGGCTTTGTGGCCCCAGA 0: 1
1: 0
2: 2
3: 14
4: 244
Right 915849472 1:159305775-159305797 CTGACTTTTCAGGAGGGGAAAGG 0: 1
1: 0
2: 4
3: 42
4: 346
915849464_915849469 -6 Left 915849464 1:159305752-159305774 CCGAGAGGCTTTGTGGCCCCAGA 0: 1
1: 0
2: 2
3: 14
4: 244
Right 915849469 1:159305769-159305791 CCCAGACTGACTTTTCAGGAGGG 0: 1
1: 0
2: 1
3: 11
4: 175
915849464_915849465 -10 Left 915849464 1:159305752-159305774 CCGAGAGGCTTTGTGGCCCCAGA 0: 1
1: 0
2: 2
3: 14
4: 244
Right 915849465 1:159305765-159305787 TGGCCCCAGACTGACTTTTCAGG 0: 1
1: 0
2: 0
3: 22
4: 175
915849464_915849471 -5 Left 915849464 1:159305752-159305774 CCGAGAGGCTTTGTGGCCCCAGA 0: 1
1: 0
2: 2
3: 14
4: 244
Right 915849471 1:159305770-159305792 CCAGACTGACTTTTCAGGAGGGG 0: 1
1: 0
2: 0
3: 13
4: 153
915849464_915849473 22 Left 915849464 1:159305752-159305774 CCGAGAGGCTTTGTGGCCCCAGA 0: 1
1: 0
2: 2
3: 14
4: 244
Right 915849473 1:159305797-159305819 GATTTATCAATACACAAGACAGG 0: 1
1: 0
2: 0
3: 9
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915849464 Original CRISPR TCTGGGGCCACAAAGCCTCT CGG (reversed) Intronic
900748536 1:4378089-4378111 TCTGGGGCCAGGAGGCCTGTTGG - Intergenic
904500350 1:30909258-30909280 TCTGAGGTCACACAGCCCCTGGG - Intergenic
905296783 1:36959454-36959476 TCAGGGGCCACACAGGCTCATGG - Intronic
905626846 1:39495075-39495097 TCTGGGGCCACCAACCTTCAGGG - Intronic
905885317 1:41488569-41488591 CCTGGGGCCACTCAGCCTCAGGG + Intergenic
905915475 1:41681617-41681639 TCTCGGGGCACACATCCTCTGGG + Intronic
914936392 1:151984596-151984618 TCTGATGCCACAAAGCCTTTAGG + Intronic
915636725 1:157192735-157192757 TCTGAGGCCACAAGGTCTATTGG + Intergenic
915849464 1:159305752-159305774 TCTGGGGCCACAAAGCCTCTCGG - Intronic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916284081 1:163085189-163085211 TCTGGGGCCACATGGCCTTGGGG - Intergenic
917288247 1:173443959-173443981 TCTGTGGCAACAAAGACTATAGG - Intergenic
918083029 1:181221976-181221998 GCTTGGGCCTCAAAGGCTCTTGG - Intergenic
918187881 1:182143924-182143946 TCTGGAACAACAAAGGCTCTGGG - Intergenic
918389271 1:184040919-184040941 TCTGGGACAACAAAACCTCTTGG + Intergenic
920336738 1:205249939-205249961 GCTGGGACCCCAAGGCCTCTGGG - Intronic
921782917 1:219189573-219189595 TCTAGAGCCACACAGCTTCTGGG + Intronic
922359749 1:224810544-224810566 GCTGGGGCCACACTGCCACTGGG - Intergenic
923024960 1:230196761-230196783 TTGAGGGCCACAAAGCCTCTGGG - Intronic
923519703 1:234726025-234726047 TCTGGGGACCCCAAGCCTGTGGG - Intergenic
1062972626 10:1660529-1660551 TCTGGGGCTCCAGAGCCCCTGGG + Intronic
1063579571 10:7293478-7293500 GCTTGGGCCAGAAAGCCTCAGGG - Intronic
1067692718 10:48512299-48512321 TCTGGTGCCAGATAGCCTATGGG + Intronic
1069635167 10:69920544-69920566 TCTAGGGCCACCAATCCTATTGG - Intronic
1070808535 10:79285530-79285552 TCTGTGGCCACATGGCCACTGGG - Intronic
1072084604 10:92066538-92066560 TCTGGAGCAACATAGCTTCTTGG + Intronic
1072438566 10:95435048-95435070 TCAGGGTCCACAGGGCCTCTTGG + Intronic
1072629236 10:97134226-97134248 TGTGGGGACACAAAGGCTGTGGG - Intronic
1073486061 10:103819888-103819910 TCTGGGGGCCCAGAGCCTTTGGG - Intronic
1075234222 10:120711895-120711917 TGTGGGCCCACCAAGGCTCTGGG + Intergenic
1077412995 11:2412102-2412124 CCTGAGGCCACACGGCCTCTGGG + Intronic
1078096058 11:8298045-8298067 GCTGAGGCCACAAAGTCTCTGGG + Intergenic
1080493390 11:32792499-32792521 TCTGTGGCCAAAAATACTCTTGG - Intronic
1080688236 11:34533699-34533721 TCCAGGGCCACAAAGCCAGTAGG - Intergenic
1081137015 11:39451030-39451052 TCTGAGCCCTCCAAGCCTCTAGG + Intergenic
1084939995 11:72607340-72607362 TCAGTGGCCACAGAGGCTCTCGG + Intronic
1085127773 11:74013472-74013494 TCTGGGGCGACAAGGCCTTTGGG + Exonic
1086501270 11:87456234-87456256 TCTGGGGCTACATAGCCTGGGGG - Intergenic
1088806653 11:113358847-113358869 TCTTGGTCCCCAAAGGCTCTTGG - Intronic
1088894770 11:114069466-114069488 GCTGGCTCCACAAAGCCTCTGGG - Intronic
1089634791 11:119805165-119805187 TCTGGGGGCCCCAAGGCTCTAGG + Intergenic
1090137299 11:124210739-124210761 TCAGGAGCCACAGAGTCTCTAGG + Intergenic
1093054455 12:14541674-14541696 TTTGGGGACAGAAAGGCTCTTGG - Intronic
1095370493 12:41461376-41461398 TCTGGGACCAAAAAGCCCCAGGG + Intronic
1095983126 12:47983915-47983937 TGTGGGTCCACACAGCCTCCTGG + Intronic
1096009141 12:48198336-48198358 TCAGGGGCCCTACAGCCTCTTGG + Intergenic
1096262686 12:50103020-50103042 TCTGAGACCACAAAGCCCCACGG + Intergenic
1096590212 12:52653280-52653302 GCTGGGACCACAGAGCCTCAGGG - Intergenic
1097444669 12:59655202-59655224 TCTGGGGAACCAAAGACTCTGGG + Intronic
1098808656 12:75054847-75054869 TCTGAGTCCTCAAAGCCACTGGG - Intronic
1101461762 12:104904395-104904417 TCTCCCGCCAAAAAGCCTCTCGG + Intronic
1101586668 12:106091249-106091271 TCTGGAGCCACCGGGCCTCTGGG - Intronic
1103264438 12:119617190-119617212 TCTGAGGCCTCCAAGTCTCTAGG - Intronic
1103913168 12:124363050-124363072 TCTGTGGACCCAAATCCTCTGGG + Intronic
1104816698 12:131650330-131650352 TCTGGGCTCCCACAGCCTCTGGG - Intergenic
1106546102 13:30732247-30732269 TCTGGGGCCCCACACCTTCTGGG - Intronic
1108780349 13:53822888-53822910 TGTGAGGCGACTAAGCCTCTGGG + Intergenic
1110500936 13:76227233-76227255 TCTGGGACCACAACTCCCCTTGG - Intergenic
1112132781 13:96542085-96542107 CCTAGGGGCAGAAAGCCTCTGGG + Intronic
1113119797 13:106913989-106914011 TCTGCTGCCCCACAGCCTCTCGG + Intergenic
1113465539 13:110510205-110510227 TCTGGGGCCACCCATCCTCACGG - Intronic
1114061550 14:19021919-19021941 TCTGTGGCAAAAAAGCATCTGGG - Intergenic
1114646388 14:24258802-24258824 ACGGGGGCCACAAGGCCTTTGGG + Intronic
1115396634 14:32916752-32916774 TCTAAGGTCACAAAGCCACTTGG - Intergenic
1121915476 14:97833835-97833857 TAGGGGGGCACAAAGCCTGTTGG - Intergenic
1122699591 14:103578984-103579006 TCTGGGGCCACACAGCCAGGTGG + Intronic
1125424830 15:39538189-39538211 TCTGTGGCCCCAAAGCCTTTGGG + Intergenic
1126207390 15:46060790-46060812 CCTCAGACCACAAAGCCTCTTGG + Intergenic
1128699968 15:69796904-69796926 CCTGGGGCCACGTAGCTTCTCGG - Intergenic
1128786007 15:70397956-70397978 GCTGGGACCACAGGGCCTCTCGG + Intergenic
1132824376 16:1896033-1896055 TCTGGGTCCACAATGCCTTCCGG - Intergenic
1136251945 16:29011264-29011286 TCCGAGACCACAAGGCCTCTGGG + Intergenic
1136642284 16:31577089-31577111 TCTGAGGCCTCCAAGTCTCTAGG - Intergenic
1137553657 16:49456718-49456740 CCTGGGGCCAAGAAGCCTCAAGG + Intergenic
1137564704 16:49525665-49525687 TCTGGGGTCTGTAAGCCTCTAGG - Intronic
1137766191 16:50979455-50979477 TATGGGACCCCAAAGCCTCCAGG + Intergenic
1138348741 16:56335368-56335390 TCTGAGGCCCCAGAGCCCCTGGG - Intronic
1139324120 16:66138745-66138767 CCTGGGGCCAAGAAGCCGCTAGG - Intergenic
1139491968 16:67291064-67291086 TCTGGGCCCACAGAGCCACAGGG + Intronic
1141808649 16:86358923-86358945 TCTGGGGCCACCCTGGCTCTGGG + Intergenic
1142595348 17:1027103-1027125 TCTGGGGCCTCATTGCCTCTGGG + Intronic
1142609739 17:1102266-1102288 TCTGTGGCCACGATGCCTCAGGG - Intronic
1143729735 17:8874319-8874341 GCTGGGTCCACACAGCATCTCGG + Intergenic
1144727229 17:17507975-17507997 GCTGGGGACACTAAGCCACTGGG + Intronic
1148240313 17:45996067-45996089 TCTGAGGCCACACAGCTTGTTGG + Intronic
1150230156 17:63545351-63545373 TCTGGGGCCACAGAGGCTCTGGG - Intronic
1150653914 17:67027275-67027297 TCTGGTGGCACCAAGCATCTGGG - Intronic
1151972839 17:77467627-77467649 TCTGGAGCCACAAAGCATTAAGG - Intronic
1152233856 17:79128388-79128410 CCTGGGTCCACAAAGCACCTGGG - Intronic
1152365775 17:79855573-79855595 TCTGGGGCCACAGAGCCCTGGGG + Intergenic
1152746774 17:82043973-82043995 CCTGGGGCACCAAAGGCTCTGGG - Intergenic
1154453075 18:14495481-14495503 TCTGTGGCAAAAAAGCATCTGGG + Intergenic
1154502251 18:15002772-15002794 CCTGGGGCCACAAAGCTCCCAGG + Intergenic
1156012363 18:32510021-32510043 TCTGGGGCCACAGAGCAGCATGG - Intergenic
1160107525 18:75992042-75992064 GCTGAGGCCACAAAGACCCTGGG - Intergenic
1160431774 18:78818156-78818178 TCTGGGGCCTCAGAGTCCCTGGG + Intergenic
1160829303 19:1095552-1095574 TCTTTGGCCGCACAGCCTCTCGG + Intergenic
1160868932 19:1268276-1268298 TCGGCGGCCCCAAAGCCTCTGGG - Intronic
1161392896 19:4030714-4030736 TCTGAGGCCACACAGCCGCCAGG - Intronic
1162266508 19:9579969-9579991 TCTGGGGCCACCATGTCTGTGGG + Intronic
1162277781 19:9671299-9671321 TCTGGGGCCACCATGTCTGTGGG + Intronic
1165820818 19:38674790-38674812 TCAGGGCCCACAGTGCCTCTTGG + Intronic
1166341461 19:42139983-42140005 TTTGGGGTCAACAAGCCTCTGGG - Intronic
1167175537 19:47861311-47861333 TCTGAGGCCACAAGGCGCCTGGG - Intergenic
925985041 2:9207818-9207840 TCTGGGTCCAAGAAGCCTCCAGG + Intronic
927785122 2:25968678-25968700 TCCTGGGTCACACAGCCTCTAGG + Intronic
934017033 2:87899027-87899049 TCTGAGGCCTCCAAGTCTCTAGG - Intergenic
934852881 2:97712660-97712682 TCTAGTGCCCCAAGGCCTCTGGG - Intergenic
935541586 2:104354595-104354617 CATGGGGCCACAGTGCCTCTTGG + Intergenic
935677365 2:105607628-105607650 TCTGGGTCCAAAAAGCCTTTTGG - Intergenic
937858300 2:126688672-126688694 TCTGGGGCCACCAAGGAGCTTGG - Intronic
937858804 2:126692282-126692304 TCTGGGGCCACCAAGGAGCTTGG - Intronic
938478908 2:131642227-131642249 TCTGTGGCAAAAAAGCATCTGGG - Intergenic
938501425 2:131832944-131832966 CCTGGGGCCACAAAGCTCCCAGG + Intergenic
939037305 2:137148505-137148527 TCTGAGCCCTCCAAGCCTCTAGG - Intronic
939326397 2:140695348-140695370 TCTGTGGCCTCTAAGCTTCTAGG + Intronic
941485970 2:166082934-166082956 TCTGGGGACATAAACCATCTGGG + Intronic
1168864413 20:1073297-1073319 TCTGGGGCCTCAAAGGACCTTGG - Intergenic
1168881885 20:1213221-1213243 TCTGGAGCCAGAAAGCCTCTGGG - Intergenic
1168906250 20:1406185-1406207 TCTTGGGCCACAAAGATTCCAGG - Intergenic
1168983679 20:2029031-2029053 TCAGGGGTCACAATGACTCTAGG + Intergenic
1171231576 20:23491251-23491273 GCTGAGGCCACAAGGCCTCTGGG + Exonic
1172182972 20:33014855-33014877 TCTGTGTTCCCAAAGCCTCTGGG - Intronic
1172440075 20:34959258-34959280 CCTGGGGCCAAAAAGACCCTGGG - Intergenic
1172871638 20:38139397-38139419 TCTGAGGGCACATACCCTCTGGG + Exonic
1173567841 20:44054555-44054577 TCCAGGACCACAAAGCCTCAGGG - Intronic
1179032641 21:37734101-37734123 TCTGGTACCTCAAAGCCTCAGGG - Intronic
1179398140 21:41060003-41060025 TCTGGGGCCAGAAACCCACACGG - Intergenic
1180480038 22:15744519-15744541 TCTGTGGCAAAAAAGCATCTGGG - Intergenic
1182797705 22:33003345-33003367 TCTGAGCCCTCCAAGCCTCTAGG - Intronic
1183151317 22:36039947-36039969 TCTGAGCCCACCAAGTCTCTAGG + Intergenic
1184399546 22:44265892-44265914 ACTGGTGCCAGTAAGCCTCTGGG + Intronic
1184812235 22:46843939-46843961 GCTGGGGCCAGAAAGCATTTGGG + Intronic
951046114 3:18040576-18040598 TCTCAGGCCACACAGCTTCTTGG + Intronic
951289129 3:20854602-20854624 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289132 3:20854619-20854641 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289138 3:20854653-20854675 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289159 3:20854768-20854790 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289166 3:20854819-20854841 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289173 3:20854868-20854890 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289176 3:20854885-20854907 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289179 3:20854902-20854924 TCTGGGGTGACAATGTCTCTGGG - Intergenic
951289182 3:20854919-20854941 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289188 3:20854953-20854975 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289191 3:20854970-20854992 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289194 3:20854987-20855009 TCTGGGGTGACAATGTCTCTGGG - Intergenic
951289203 3:20855038-20855060 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289218 3:20855119-20855141 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289227 3:20855168-20855190 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289230 3:20855185-20855207 TCTGGGGTGACAATGTCTCTGGG - Intergenic
951289249 3:20855304-20855326 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289263 3:20855387-20855409 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289266 3:20855404-20855426 TCTGGGGTGACAATGTCTCTGGG - Intergenic
951289269 3:20855421-20855443 TCTGGGGTGACAATGTCTCTGGG - Intergenic
951289272 3:20855438-20855460 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289297 3:20855574-20855596 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289300 3:20855591-20855613 TCTGGGGTGACAATGTCTCTGGG - Intergenic
951289305 3:20855625-20855647 TCTGGGGTGACAATGTCTCTGGG - Intergenic
951289315 3:20855691-20855713 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289318 3:20855708-20855730 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289324 3:20855746-20855768 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289327 3:20855763-20855785 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289330 3:20855780-20855802 TCTGAGGTGACAAAGACTCTGGG - Intergenic
951289334 3:20855814-20855836 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289347 3:20855889-20855911 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289353 3:20855927-20855949 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289356 3:20855944-20855966 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289362 3:20855982-20856004 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289373 3:20856069-20856091 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289391 3:20856199-20856221 TCTGGGGTGACAATGTCTCTGGG - Intergenic
951289394 3:20856216-20856238 TCTGGGGTGACAATGACTCTGGG - Intergenic
951289397 3:20856233-20856255 TCTGGGGTGACAATGTCTCTGGG - Intergenic
951289400 3:20856250-20856272 TCTGGGGTGACAATGACTCTGGG - Intergenic
951397870 3:22192280-22192302 TCTGGGGAAACAAAGGCTATTGG - Intronic
953133496 3:40162891-40162913 TCTGGGGTAACAATGCATCTGGG - Intronic
954493599 3:50930971-50930993 TCTGGGGCCACAGAGGCTCCGGG + Intronic
954943147 3:54393449-54393471 TCAGTGGCAACAAAGCCTCAGGG - Intronic
957006292 3:74951872-74951894 TCTGGGAGCAGCAAGCCTCTTGG - Intergenic
959108737 3:102096663-102096685 TCTGGGGTCACAAAAGATCTGGG + Intergenic
961006632 3:123410040-123410062 TATGGGGCCACACTGCCTCAGGG - Intronic
965241146 3:166200022-166200044 ACTGGGGCACAAAAGCCTCTAGG + Intergenic
965404173 3:168249696-168249718 TCAGCGGCCACCGAGCCTCTGGG + Intergenic
967886423 3:194336708-194336730 CCGGGGGCTACAAAGCGTCTGGG - Intergenic
968121458 3:196128784-196128806 ACTGTGGCCACAAAGCCTCGGGG - Intergenic
968540367 4:1165256-1165278 TCTGGGGCCCCCACGCCACTAGG - Intergenic
968612674 4:1564236-1564258 CCTGAGGCCACATAGCCTCTGGG - Intergenic
968641242 4:1716213-1716235 CCTGCGGCCCCAAAGCCCCTGGG - Exonic
968967272 4:3775489-3775511 TCAGGGGCCCCAAAGCCTGGGGG - Intergenic
969588131 4:8106413-8106435 CCTGGGCCCGCAAAGCCTCCTGG - Intronic
971083541 4:23243913-23243935 TCTGGGGCCAAGAAGCCCCAAGG + Intergenic
972017473 4:34264235-34264257 TCTGAGTCCACCAAGTCTCTAGG + Intergenic
976283447 4:83347679-83347701 TCTGGGCCCTCCAAGTCTCTGGG + Intergenic
979038286 4:115753855-115753877 TCTGAGGCCTCCAAGTCTCTAGG - Intergenic
979832818 4:125321377-125321399 ACTGGGGCCTCAGATCCTCTGGG - Exonic
980385975 4:132088486-132088508 TCTGAGCCCTCCAAGCCTCTAGG - Intergenic
984899588 4:184573283-184573305 TCTAGGGCCACAAAGCCATAAGG + Intergenic
985394211 4:189524970-189524992 TCTGAGGTCTCAAAGTCTCTAGG - Intergenic
986736553 5:10672632-10672654 TCTGGGTCCTTAAAGCATCTCGG - Intergenic
987248919 5:16079311-16079333 TCTAGGGCCTCAAAGTCTTTAGG - Intronic
991968269 5:72112811-72112833 GCTGGGGAAACAAAGCCTCCAGG + Intronic
992390676 5:76327998-76328020 TCTGTGGTCACAAACCTTCTTGG + Exonic
992566458 5:77999637-77999659 GCTGGGGCCAGCAGGCCTCTGGG + Intergenic
995832702 5:116371647-116371669 TCCCGGCCCACACAGCCTCTTGG - Intronic
998377209 5:141699170-141699192 TCTGAGGTCACACAGCCTGTGGG - Intergenic
1000415449 5:160979561-160979583 TCTGGGACCACAAAACCTACTGG - Intergenic
1001236579 5:170034852-170034874 TTTGGAGTCACACAGCCTCTGGG + Intronic
1001934421 5:175694354-175694376 ACTGGGGCCAGACAGCCTCCGGG - Intergenic
1003322492 6:5063903-5063925 TCTGGGCACACTAGGCCTCTGGG + Intergenic
1004808504 6:19232006-19232028 CCTGGGTCCAGAATGCCTCTGGG - Intergenic
1006505499 6:34486228-34486250 TTTGGGGCCACAGTGTCTCTAGG + Intronic
1007396635 6:41581691-41581713 ACTGGGGTCACAAAGGGTCTGGG - Intronic
1010393933 6:75369098-75369120 TCTGAGGCAACAAAGTCCCTGGG - Intronic
1011948408 6:92935328-92935350 TCTGAGGCCTCCAAGTCTCTGGG + Intergenic
1015065399 6:129020287-129020309 TCTGGGGCCACAACTATTCTTGG + Intronic
1017482922 6:154875072-154875094 TCTGGAGGCACAAAGTCTGTCGG + Intronic
1018527383 6:164728213-164728235 TCTGAGGCCTCCAAGTCTCTAGG - Intergenic
1019526545 7:1483025-1483047 TCTGGCTCCGCAAAGCCACTGGG + Intronic
1019639980 7:2098182-2098204 CCTGGGGCCTCAAAGACTCAAGG - Intronic
1021511813 7:21441373-21441395 TGTGAGACCACTAAGCCTCTAGG - Intronic
1023966975 7:44967821-44967843 CCTGGGGCCCCAGAGACTCTGGG - Intronic
1023983431 7:45082305-45082327 TCAGGAACCACACAGCCTCTGGG - Exonic
1024051409 7:45626018-45626040 TCCAGAGCCACCAAGCCTCTAGG - Intronic
1024446489 7:49485333-49485355 TCTGGGACCAGAACGTCTCTTGG - Intergenic
1031411337 7:121442961-121442983 TCTGAGGTCACAAATCATCTAGG + Intergenic
1034939017 7:155218492-155218514 TCTGGAGCCAGACAGCCTCGGGG + Intergenic
1035221391 7:157408451-157408473 TCTGGGGACACACAGGCTCCAGG + Intronic
1035871384 8:3139385-3139407 TCAGGGGCCAGAAAATCTCTGGG - Intronic
1037805724 8:22057095-22057117 TCTGTGGCCTCAGAGCGTCTGGG + Intronic
1038133323 8:24758661-24758683 GCAGGGGCAACAAAGCCTCAGGG - Intergenic
1041851987 8:62402932-62402954 TCTGAGCCCACCAAGTCTCTAGG - Intronic
1042180533 8:66082920-66082942 TGTGCAGCCACAAAGCCTCAGGG - Intronic
1044616175 8:94144423-94144445 TTTGTGGCAACAAAGTCTCTTGG - Intronic
1046472744 8:114699785-114699807 TCTGGAGCCACAAAGGGTTTAGG - Intergenic
1048286470 8:133145732-133145754 TCTGAGGCTACAAAGGCTCCTGG + Intergenic
1048605928 8:135968801-135968823 GCTCTGGCCACAAAGCCACTTGG + Intergenic
1049006652 8:139859894-139859916 TCTGGGGCCACAGACCCCTTGGG + Intronic
1049625429 8:143617640-143617662 TCCGCGGCCGCAAAGCCGCTTGG + Intronic
1049628332 8:143636607-143636629 CCTGGGGCCTCGAGGCCTCTCGG + Intronic
1050255791 9:3790633-3790655 TCTGAGCCCTCCAAGCCTCTAGG + Intergenic
1052270933 9:26627233-26627255 TCTGGGTCTTCAAAGCCTTTTGG - Intergenic
1053005231 9:34599882-34599904 TTTGAGGCCACAAAGCCAGTAGG - Intergenic
1053480939 9:38415795-38415817 TCTGGAGCCCCATAGCCCCTGGG + Intronic
1053814539 9:41893797-41893819 TCTGCAGCCTCAGAGCCTCTGGG - Exonic
1054616057 9:67293643-67293665 TCTGCAGCCTCAGAGCCTCTGGG + Intergenic
1054868418 9:70026286-70026308 TCTGGGCCCTCCAAGTCTCTAGG + Intergenic
1055816617 9:80213655-80213677 CCTGGCGTCTCAAAGCCTCTGGG + Intergenic
1056467078 9:86868192-86868214 TCTGAGGTCACACAGACTCTTGG - Intergenic
1057268238 9:93632932-93632954 ACTGGGGCATCATAGCCTCTGGG - Intronic
1057339033 9:94182804-94182826 CCTGAGACCACAAAGCTTCTAGG + Intergenic
1061212332 9:129201113-129201135 TCTGGGGACAGAAAGCCCCAGGG + Intergenic
1061721171 9:132552291-132552313 CATGGAGCAACAAAGCCTCTGGG + Intronic
1062326902 9:136016879-136016901 TCTGGGGCCACAAAAACTGCTGG + Intronic
1062345971 9:136115474-136115496 GCTGGTGCCACACAGGCTCTGGG + Exonic
1185446583 X:261110-261132 TCTGGGGGCACAGAGCACCTTGG + Intergenic
1187598320 X:20799391-20799413 TCTGAGGCCTCCAAGTCTCTAGG - Intergenic
1188134793 X:26482785-26482807 TCTGAGCCCTCAAAGTCTCTAGG - Intergenic
1188873227 X:35399238-35399260 TCTGAGCCCTCCAAGCCTCTAGG + Intergenic
1189293915 X:39905402-39905424 TCTGGGAACACAAAGCCGCAGGG + Intergenic
1199127450 X:144139518-144139540 TCTGAGGCCTCCAAGTCTCTAGG + Intergenic
1199236589 X:145500699-145500721 TCTGGGGCCAGACTGCCTATTGG - Intergenic
1199872457 X:151912204-151912226 CCTTGGGCGACAAAGCCGCTGGG - Intergenic