ID: 915849560

View in Genome Browser
Species Human (GRCh38)
Location 1:159306667-159306689
Sequence CAGCTTAGGAGGGCTGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 391}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915849560 Original CRISPR CAGCTTAGGAGGGCTGGGAA AGG Intronic
900018410 1:170424-170446 CAGGTTGGCAGGGCTGGGGAAGG + Intergenic
900048666 1:529019-529041 CAGGTTGGCAGGGCTGGGGAAGG + Intergenic
900070895 1:770843-770865 CAGGTTGGCAGGGCTGGGGAAGG + Intergenic
900121092 1:1049052-1049074 CAGCTCAGGTGGGCGGGGAGGGG + Exonic
900121108 1:1049087-1049109 CAGCTCAGGTGGGCGGGGAGGGG + Intronic
900294347 1:1941352-1941374 CAGCTCTGGGGGGCTGGGATCGG + Intronic
900400527 1:2471159-2471181 CAGCTGGGGATGGCTGGGGACGG + Intronic
900697435 1:4021050-4021072 CAGCTTTAGAAGGCTGGGGAGGG + Intergenic
900943228 1:5814587-5814609 CGGCCTAGGCGTGCTGGGAAAGG + Intergenic
901795471 1:11677046-11677068 CAGCTGAGCAGGGCTGTGAGTGG - Intronic
902740887 1:18437157-18437179 GGGCTTAGGAGGGCTGGAATTGG - Intergenic
903741739 1:25562454-25562476 CTGCTTTGGAGACCTGGGAAGGG + Intronic
904598589 1:31661789-31661811 CATCTTAGGATAGCTGGGGAGGG - Intronic
907782654 1:57581208-57581230 AAGCTTTGGAGGATTGGGAAAGG + Intronic
908010226 1:59768891-59768913 CAGCTTAGCAGAGCTGAGAAAGG - Intergenic
908525065 1:64980093-64980115 AAGCTTTGGAGGGGAGGGAAAGG + Intergenic
909526645 1:76631159-76631181 TTTCTTAGGAGGGGTGGGAAAGG + Exonic
909784436 1:79593410-79593432 CAGGTTAAGAGTGCTGGTAAGGG - Intergenic
912209532 1:107543362-107543384 TAGCTCAGGAGGGCTGGGTGTGG + Intergenic
912515358 1:110213414-110213436 CAGCACAGGGGTGCTGGGAAAGG - Intronic
914427346 1:147589496-147589518 CAGATTAGTTGGGGTGGGAATGG - Intronic
914715274 1:150249237-150249259 TATCTTAGCAGGGCCGGGAACGG + Intergenic
915141711 1:153772199-153772221 CAGCCTGGGAGGGCTGGGGTTGG - Intronic
915512163 1:156392282-156392304 CAGCTGAGGAGAGCTTGGGAAGG + Intergenic
915839629 1:159203834-159203856 CAGCTGAGGAGGGGAGGGAGGGG + Intronic
915849560 1:159306667-159306689 CAGCTTAGGAGGGCTGGGAAAGG + Intronic
918133809 1:181652242-181652264 CATCTTAGGAGAGCTGAGACGGG + Intronic
919033204 1:192272197-192272219 CAACTTAGAAGGCCTAGGAATGG - Intergenic
920218302 1:204377348-204377370 CAGCTTGGAAAGGCTGGGCAGGG - Intronic
920741859 1:208588375-208588397 CAGCGTATCAGGTCTGGGAAGGG - Intergenic
922096178 1:222444928-222444950 CAGCTGGAGAGAGCTGGGAAGGG - Intergenic
922106261 1:222516289-222516311 CAGGTTGGCAGGGCTGGGGAAGG + Intergenic
923976902 1:239274166-239274188 CAGCTTAAGAGGGCTTGAATTGG - Intergenic
924240048 1:242031740-242031762 CAGGTTATGAGGGATGGGGAGGG + Intergenic
924348441 1:243093854-243093876 CAGGTTGGCAGGGCTGGGGAAGG + Intergenic
1063747205 10:8898150-8898172 AGGCCTAGGAGGGGTGGGAAAGG - Intergenic
1065348856 10:24776864-24776886 CGGCTTTGGATGGCTGGGATGGG + Intergenic
1065611082 10:27471093-27471115 CAGCTCTGGAGGGATGGGGAGGG + Intergenic
1066727919 10:38411047-38411069 CAGGTTGGCAGGGCTGGGGAAGG - Intergenic
1067173042 10:43923139-43923161 CAGTTCAGTAGGGCTGGGGAAGG - Intergenic
1068129429 10:52879057-52879079 TACCTTGGGAGGGCTGGGCATGG + Intergenic
1069884411 10:71614549-71614571 CATCTTCAGAGGGCCGGGAAGGG + Intronic
1071518487 10:86314728-86314750 CATCTGAGGAGTGCTGGGAAAGG - Intronic
1071776319 10:88792225-88792247 CAGGTTTGAAGGGATGGGAAAGG + Intergenic
1074417694 10:113281788-113281810 CAGCTTAAGTGTGATGGGAATGG + Intergenic
1074610590 10:115017386-115017408 GAGCTGAGGGGGGCTGGGCATGG + Intergenic
1074717083 10:116229576-116229598 CTCCTAAGGAGGGGTGGGAAGGG - Intronic
1075287984 10:121203631-121203653 CAGCTGAGGGGGCCTGGAAAGGG - Intergenic
1075558317 10:123449306-123449328 CAGGTGAGGAGGGCAGGGCAGGG - Intergenic
1076204225 10:128582230-128582252 GTGCTTGGGTGGGCTGGGAATGG - Intergenic
1076975013 11:165620-165642 CAGGTTGGCAGGGCTGGGGAAGG + Intergenic
1077005107 11:351332-351354 CACCTTAGGAGGGTTGGTTAGGG - Intergenic
1077014290 11:393077-393099 AAGCCTAGGAGGGCTGGGGGTGG - Intronic
1077122084 11:914284-914306 CGGGTAAGGAGGGCTGGGAATGG - Intronic
1077473183 11:2774417-2774439 GAGATCAGGAGGGCTGGGATGGG - Intronic
1077610091 11:3638779-3638801 CCACTTAGGAGCCCTGGGAACGG - Exonic
1078070498 11:8105866-8105888 CAACTTAGGATGGCTAGGAAAGG + Exonic
1079014482 11:16856950-16856972 CTGCTTTGGAGGCCTGGGCAAGG + Intronic
1079449412 11:20586599-20586621 AAGCTTAAGAGGGCCGGGCACGG + Intergenic
1079792508 11:24755920-24755942 CAGGATTGGAGGGCTTGGAAGGG - Intronic
1080706575 11:34701251-34701273 CAGCAGAGGAGGCCTGGGCAGGG + Intergenic
1081744166 11:45461485-45461507 CAGCTCAGGAGCGCTGAGGAAGG - Intergenic
1082723813 11:56711117-56711139 CAGCTTACAAGGGATGTGAAGGG - Intergenic
1083145703 11:60756910-60756932 CAGCTGAAGGGGGCTGGGAGAGG - Intergenic
1084519081 11:69652058-69652080 CAGCGTAGCAGGGTCGGGAAAGG + Exonic
1084649443 11:70480148-70480170 CAGATGAGGAGGGCTGGGCAGGG - Intronic
1085324876 11:75598887-75598909 CAGCTTGGGAGGTGCGGGAAAGG + Intronic
1087861120 11:103158155-103158177 TAGCTTAGCAAGGCTGGGCATGG + Intronic
1088065131 11:105708305-105708327 CAACATAGGGTGGCTGGGAATGG + Intronic
1088170902 11:106995427-106995449 CAGCTTAGAAGGGCAGGTTAAGG - Intronic
1089056824 11:115592314-115592336 CAGCTGATGAGGGCTGGGGCAGG - Intergenic
1089837289 11:121382268-121382290 GAGCTTTGAAGGGCTGGGGAGGG + Intergenic
1090242156 11:125191698-125191720 CAGCTCAGGAGGGCTGGATGAGG + Intronic
1090426221 11:126608655-126608677 TAGCCAGGGAGGGCTGGGAAGGG - Intronic
1091795820 12:3297013-3297035 CAGAGTTGGAGGGCTGAGAAGGG - Intergenic
1091807043 12:3364336-3364358 CAGCTGAGGAGGGGAGGGGAGGG - Intergenic
1091853217 12:3717759-3717781 CAGCTGTGGAGGGCTGGGCCTGG + Intronic
1092195631 12:6548189-6548211 CAGCCAAGGAGGGATGGGATGGG + Intronic
1092329598 12:7571528-7571550 CAGGGAAGGAGGGCTGGGGAAGG - Intergenic
1092979844 12:13783882-13783904 CACCTTAGCAGGTCAGGGAAAGG + Intronic
1096465863 12:51847645-51847667 CAGAGGAGGAGGCCTGGGAAGGG - Intergenic
1097469165 12:59967318-59967340 CAGTTCAGCAGGGCTGGGGAAGG + Intergenic
1101828468 12:108239266-108239288 TAGCTCAAGAGAGCTGGGAAGGG - Intronic
1101880436 12:108622467-108622489 CAGCCTGTGAGGGCTGGGATGGG - Intronic
1102942212 12:116953390-116953412 CAGCAAATGAGGGCTGGAAACGG - Intronic
1103892376 12:124249639-124249661 CAGCTTAGGAGGGTTCTGGAAGG + Intronic
1105393372 13:20003937-20003959 CAGCAGAAGAGGGCTGGGCATGG - Intronic
1106653511 13:31717636-31717658 CAGGGTAGAAGGGCAGGGAAAGG - Intergenic
1107390080 13:39954617-39954639 CAGATTAGAAGGGCTGGGGTTGG - Intergenic
1107415242 13:40193892-40193914 CAGCTAAGTAGGGGTGGGCAGGG + Intergenic
1108466965 13:50726312-50726334 CAGCTGAGGAGGGGTGGGTGGGG - Intronic
1108525239 13:51280725-51280747 CAGCTGAGGAGGCCAGGGAGGGG - Exonic
1109372201 13:61437372-61437394 CATCTCAGAAGGGCTGAGAAAGG + Intergenic
1109525169 13:63566176-63566198 CTGCTGAGCAGTGCTGGGAATGG - Intergenic
1110438749 13:75504516-75504538 CTGCTTAGGAGAAATGGGAAAGG - Intergenic
1113004123 13:105679325-105679347 CACATTTGGAGGGGTGGGAATGG + Intergenic
1113733524 13:112658995-112659017 CTGCCTAAGAGGCCTGGGAAGGG - Intronic
1114434850 14:22697565-22697587 CTGCTTAGGAGGACTGGGCTTGG + Intergenic
1115372494 14:32633691-32633713 CTGCTTAGGATGGCTGTGAGTGG - Intronic
1115637049 14:35299906-35299928 CTGCCTAGGAGAGCCGGGAAAGG + Intronic
1117328775 14:54692254-54692276 CACCTCAGGAAGTCTGGGAAGGG - Intronic
1118319117 14:64743043-64743065 CAGCCGAGGAGGGCTTGGGAGGG - Exonic
1202870126 14_GL000225v1_random:155062-155084 CAACTAAGGACGGCTGGGACTGG - Intergenic
1124568049 15:30834225-30834247 CAGCTTGGGAGAGCTTGGATTGG + Intergenic
1125795226 15:42399432-42399454 CAGGTGAGGAGGGCTGGGAACGG - Intronic
1126419429 15:48455652-48455674 CTTCTTAGGAAGGCTCGGAAGGG + Intronic
1127298321 15:57629425-57629447 CTGCTTAGGATGGATGGAAATGG - Intronic
1127756526 15:62097755-62097777 CAGCATAGGGGGACAGGGAAGGG - Intergenic
1128136212 15:65265549-65265571 CAGCTCAAGAGGGGAGGGAAAGG + Intronic
1128182797 15:65619734-65619756 GAGCTTTGGAGGGCAAGGAAAGG + Intronic
1128358245 15:66943336-66943358 CAGCTCTGGGGGGCAGGGAAAGG + Intergenic
1129222282 15:74137912-74137934 CAGCTTTGCTGGTCTGGGAAGGG - Intronic
1129465453 15:75722077-75722099 CACATGAGGAGGTCTGGGAACGG + Intergenic
1129760431 15:78126087-78126109 CAGCCCAGGAGGGCTGGGAATGG + Intronic
1130258667 15:82337710-82337732 CAGCTGTGGAGGGCCGGGGAGGG - Intergenic
1130270018 15:82441374-82441396 CAGCTGTGGAGGGCCGGGGAGGG + Intergenic
1130462351 15:84168687-84168709 CAGCTGTGGAGGGCCGGGGAGGG + Intergenic
1130473972 15:84247609-84247631 CAGCTGTGGAGGGCCGGGGAGGG + Intergenic
1130481384 15:84361677-84361699 CAGCTGTGGAGGGCCGGGGAGGG + Intergenic
1130490321 15:84426098-84426120 CAGCTGTGGAGGGCCGGGGAGGG - Intergenic
1130501913 15:84504856-84504878 CAGCTGTGGAGGGCCGGGGAGGG - Intergenic
1130596252 15:85252250-85252272 CAGCTGTGGAGGGCCGGGGAGGG + Intergenic
1130645952 15:85727270-85727292 GACATCAGGAGGGCTGGGAAGGG - Intronic
1131019707 15:89088062-89088084 CTGCTTTAGAGGGCTGGGTAAGG - Intronic
1131086599 15:89580783-89580805 CAGCTTTGGAAGGCTGAGACAGG + Intronic
1131179646 15:90231067-90231089 CAGCTGAGCAGGCCTGGGAGCGG - Intronic
1131183882 15:90258695-90258717 CTGCTCAGGTGGTCTGGGAAAGG + Intronic
1132203328 15:99969953-99969975 CAGATTAGAAGGGCTGGGGTTGG - Intergenic
1132368613 15:101277228-101277250 GAGCCTGGGAGGCCTGGGAACGG - Intronic
1132464426 16:71239-71261 CTACTTGGAAGGGCTGGGAAAGG + Intronic
1132555093 16:568829-568851 CCGATTAGGAGGCCTGGGCAGGG - Exonic
1132724398 16:1332643-1332665 CGCCTTAGGAGGCCGGGGAAGGG + Intergenic
1132922349 16:2404124-2404146 CTGCTAAGCAGGGCTGGGGATGG - Intergenic
1133000850 16:2850695-2850717 CAGCAAAGGAGGGCTGGAGAGGG + Intergenic
1133092557 16:3415596-3415618 TAGCATAGGAGGGCTGGCATAGG + Intronic
1133184661 16:4086948-4086970 AAGCTTTGGAGGGCTGGGCGTGG - Intronic
1134077134 16:11299886-11299908 CAGCCTAGGAAGGCTGGGCCAGG + Intronic
1134465356 16:14471654-14471676 CACCTGAGGAGAGGTGGGAATGG - Intronic
1137584254 16:49654531-49654553 AAGCCCGGGAGGGCTGGGAATGG + Intronic
1137757879 16:50917015-50917037 CTTCTTGGGAGGGCTGGGGAAGG - Intergenic
1138645967 16:58425262-58425284 GGGCTTAGGAGGGCTGAGACAGG + Intergenic
1139374451 16:66488017-66488039 CAGCATGAGAGGGCAGGGAAGGG + Intronic
1140982777 16:80126679-80126701 CAACTGATGAGGGGTGGGAATGG - Intergenic
1141343045 16:83221208-83221230 CTGCTTACCGGGGCTGGGAAGGG + Intronic
1141461727 16:84181861-84181883 GAGCTGAGGAGGGATGGAAAGGG + Exonic
1141462253 16:84184465-84184487 CAGCATAGTAGGGTTGGGAGAGG - Intronic
1141479951 16:84299812-84299834 CTGCTGAGGGGGGCTGGGAGGGG + Intronic
1141910112 16:87053123-87053145 CAGCTGGGGAGGGCTGGGGGCGG - Intergenic
1142445250 16:90132039-90132061 CAGGTTGGCAGGGCTGGGGAAGG - Intergenic
1142462259 17:103427-103449 CAGGTTGGCAGGGCTGGGGAAGG + Intergenic
1142566555 17:844040-844062 CAGCTAAGGAGGGGCGGGACGGG - Intronic
1142566609 17:844254-844276 CAGCTAAGGATGGGTGGGACGGG - Intronic
1142752563 17:1997813-1997835 CCGAGTAGGAGGGCTGTGAAGGG - Intronic
1142807093 17:2376877-2376899 CAGGTCTGGAGGGGTGGGAATGG + Intronic
1142851054 17:2704961-2704983 CAGCTCAGGAGGGATGGAAGAGG - Intronic
1143375482 17:6464495-6464517 CTGCTTGGGCGGGCCGGGAAGGG - Intronic
1144145445 17:12393434-12393456 CAGCTGAGGAGGTCTGAGTAGGG - Intergenic
1144398556 17:14871053-14871075 AACCTTAAGAGGGCAGGGAAAGG + Intergenic
1145242224 17:21246754-21246776 CAGCAGAGGAGGGGTGGGGAGGG + Intronic
1145416202 17:22715748-22715770 CAGGTGAGGAATGCTGGGAAGGG + Intergenic
1145816159 17:27796556-27796578 GAGCTGAGGAAGGCTGGGATGGG + Intronic
1146060134 17:29600602-29600624 CAGCTTAATGAGGCTGGGAAGGG + Intronic
1146162059 17:30565367-30565389 CAGCTTAGGGGGGCTGAGGAGGG + Intergenic
1147374538 17:40015962-40015984 GAGCTGGGGAAGGCTGGGAAGGG + Intronic
1147491067 17:40866889-40866911 TAGCTTTGGAGGGCTGGGGATGG - Exonic
1148584402 17:48767250-48767272 TGGCATAAGAGGGCTGGGAAGGG - Intronic
1148991957 17:51673864-51673886 CGGCTTATGTGGGCTGGGCAGGG - Intronic
1149574166 17:57699743-57699765 CACCTTTGGAGGGTTGGCAAAGG - Intergenic
1149907818 17:60542747-60542769 ATGCTTATGAGGGCTGGGCATGG - Intergenic
1149989218 17:61371799-61371821 CGGCTGAGCAGGGCTGGGCATGG - Intronic
1150212388 17:63448216-63448238 CAGCTTGGGAAAGGTGGGAAAGG + Intergenic
1152023944 17:77796749-77796771 CAGCTGGGGACAGCTGGGAATGG + Intergenic
1153241206 18:3033020-3033042 CAGTTTATAAAGGCTGGGAACGG + Intergenic
1153339778 18:3961699-3961721 CAGCTTTGCAGGCCTTGGAAGGG + Intronic
1153624178 18:7007568-7007590 CATCTTTGGAGGGATGGAAATGG - Intronic
1154005370 18:10523136-10523158 CAGCTTAGAAGAACTGAGAATGG - Intergenic
1157238622 18:45988139-45988161 CAGATAAAGAGGGCTGGGCATGG + Intronic
1159931646 18:74318498-74318520 CAGCTTAAGAGGGCCGGGCGTGG + Intronic
1160386102 18:78497878-78497900 GAGCTCAGGAGGGCTGGAAGCGG + Intergenic
1160572303 18:79826368-79826390 CAGCTGGGCAGGCCTGGGAAGGG - Intergenic
1160651965 19:235803-235825 CAGGTTGGCAGGGCTGGGGAAGG + Intergenic
1160810012 19:1009217-1009239 CGGCTCCGGAGGGCTGGAAACGG + Exonic
1160812599 19:1019444-1019466 CACCTGAGCAGGGCTGTGAAGGG - Intronic
1160907375 19:1457807-1457829 CATCTTAGAGAGGCTGGGAAAGG + Intronic
1162733183 19:12731210-12731232 CAGGGTAGGAGGGCTGTCAATGG - Intronic
1162909533 19:13841790-13841812 CAGCTGGGGAAGGTTGGGAAGGG + Intergenic
1162913125 19:13860700-13860722 CAGCTGAGGAGGTCTGGAATGGG + Intergenic
1163554660 19:17985109-17985131 CAGCTTGGGGGGGCAGGCAAAGG + Intronic
1164552755 19:29225483-29225505 CTGCTGAGGAGTGGTGGGAAAGG - Intergenic
1164615265 19:29663872-29663894 CAGCTGAGAAGGGAAGGGAAAGG - Intergenic
1165837646 19:38769667-38769689 CAGGTGAGGAGGCCTGGGAGAGG - Intronic
1166008568 19:39924730-39924752 CAGCTGGGGAGGGAAGGGAACGG + Exonic
1166359714 19:42248022-42248044 GGGCTGAGGAGGGCTGGGAGTGG + Exonic
1166752037 19:45168869-45168891 GAGGTGAGGAGCGCTGGGAATGG + Intronic
1167661856 19:50799884-50799906 CAGCTTAGAAGAGCTGGGCCGGG - Intronic
925426331 2:3751558-3751580 CAGCTCAGGAGGCCTGGATAAGG - Intronic
925449948 2:3960601-3960623 CAGGAAAGGAGGGCTGAGAAAGG - Intergenic
926292303 2:11540863-11540885 CAGCTGAGGAAGGATGGGAATGG - Intronic
926657938 2:15429556-15429578 AAGCTAATGAGGTCTGGGAAGGG + Intronic
926750003 2:16191112-16191134 CAGCTAAGCAAGGCCGGGAAGGG + Intergenic
928387750 2:30884450-30884472 CAGCTCTGCAGGGCTGGCAAAGG - Intergenic
929778491 2:44942939-44942961 CAGCCTCAGAGGCCTGGGAAGGG + Intronic
930582320 2:53227224-53227246 CAGGTAAGGAGTGCTGGGCAAGG + Intergenic
931370659 2:61659685-61659707 CAGATTAGAAGGGGAGGGAAGGG - Intergenic
931895918 2:66729546-66729568 AAGTTGGGGAGGGCTGGGAAGGG - Intergenic
932218732 2:69983974-69983996 GACCTCAGGAAGGCTGGGAAAGG - Intergenic
932282686 2:70508152-70508174 AAGACTAGGAGGGCTGGGCATGG + Intronic
932299551 2:70656517-70656539 CAGTTTAGGTGGGTTGGGATAGG - Intronic
933652375 2:84859753-84859775 CAGTTCAGGAGGTCTGGGATGGG + Intronic
934800473 2:97152236-97152258 CAGCTTGGGAGGCCTAGGCAGGG - Intronic
935140893 2:100351988-100352010 GGGCTTAGCAGGGCTGGGACCGG + Intergenic
935818899 2:106874141-106874163 CAGTTTAGCAGGGATGGGAAGGG + Intronic
936350357 2:111707644-111707666 AAACTTAGGAGGGCTGGGCACGG - Intergenic
937079166 2:119128016-119128038 CAGCTTGGGAGAGGAGGGAACGG + Intergenic
937864450 2:126738403-126738425 CAGATAAGTAGGGCTGGGCATGG - Intergenic
942963874 2:181865969-181865991 CAGCATTGAAGGGCTGGGGATGG + Intergenic
943872056 2:193012111-193012133 CAGCCTGGGAGGGCTGGGCCAGG - Intergenic
943880251 2:193134004-193134026 CAGTTTAGGACTGCTGGCAATGG + Intergenic
944964520 2:204914907-204914929 CAGCCAAGGAGGTCTGTGAAGGG + Intronic
946526922 2:220530622-220530644 CAGATTAGCAGTGCTGGGAGTGG - Intergenic
946963349 2:225008907-225008929 CAGCTTATGAGAGGTGGAAACGG - Intronic
947396565 2:229693290-229693312 CAGTTTTGCAGGGCTGGGGAGGG - Intronic
948061552 2:235046152-235046174 GAGATGAGGAGGTCTGGGAAAGG - Intronic
948460113 2:238125143-238125165 CATCTGAGAAGGGCTGGGACAGG - Intronic
948676701 2:239601145-239601167 CAGCTCTGGAGCGCTGGGCAAGG + Intergenic
948839482 2:240642054-240642076 ACGCTTGGGAGGCCTGGGAAAGG + Intergenic
949076782 2:242064256-242064278 CATCTTAGGAGGCCAGGGCAGGG - Intergenic
1169105487 20:2990782-2990804 CAGAATAGGAGGTCTGGTAAAGG + Intronic
1169913539 20:10666474-10666496 CATCCCAGGAGGGCTTGGAAAGG + Intronic
1169984011 20:11421948-11421970 CAACTTAAGAGGGATGTGAAGGG - Intergenic
1170100733 20:12696532-12696554 CAGATTAGGAGGAATGGGCATGG + Intergenic
1170176038 20:13471151-13471173 CAGAGTAGGAGGGCAGGAAAAGG + Intronic
1170786136 20:19469217-19469239 GAGATGAGGAGGACTGGGAAGGG + Intronic
1173301786 20:41809898-41809920 TAGCTGAGAAGGGCTGGGAAGGG + Intergenic
1173985789 20:47260323-47260345 CAGCGCAGGAGGGATGTGAATGG - Intronic
1173991969 20:47310505-47310527 CAGATTAGGAGGGCCAGGCACGG + Intronic
1174178984 20:48663084-48663106 CAGCTGAGGTGGGCAGGTAAGGG - Intronic
1175062120 20:56253086-56253108 GAGTTTAGCAGGGCTGGGTAAGG - Intergenic
1175231938 20:57479398-57479420 CTGCTAAGGAGGGCTGGGACAGG + Intergenic
1175277559 20:57782624-57782646 CAGCTTTGGGGAGCGGGGAAGGG - Intergenic
1175915359 20:62423458-62423480 CAGCTGAGGAGGGCCAGGAGGGG + Intronic
1176236546 20:64056304-64056326 CAGCAGAGGAGGGCAGGGGATGG - Intronic
1178451387 21:32704650-32704672 GAGCTTGAGAGGGATGGGAAAGG + Intronic
1179457426 21:41508643-41508665 CAGCCTAGGCGGACTGGGGAGGG - Intronic
1179647398 21:42784305-42784327 CAGCAGAGGAGGGCAGGGAGAGG - Intergenic
1179979409 21:44888479-44888501 CAGGTGAGGAGGGGAGGGAAAGG + Intronic
1182197431 22:28533341-28533363 CAGCTTACAAGGGATGTGAAGGG + Intronic
1182372455 22:29821016-29821038 CAGGTGAGGAGAGCTGGCAAGGG + Intronic
1182885556 22:33771066-33771088 TAGCCTTGGAGGGCTGGCAACGG - Intronic
1183374458 22:37454868-37454890 CAGCGTCAGGGGGCTGGGAATGG - Intergenic
1183442348 22:37830340-37830362 CAGGTTGGCAGGGCTGGGGAAGG - Intergenic
1183466919 22:37984565-37984587 CCGCTGCGGAGGGCTGGGGAAGG + Intronic
1184423997 22:44398428-44398450 CAGCTTATGGAGGCTGTGAAGGG + Intergenic
1185044272 22:48521114-48521136 CATGTGAGGAGGGCTGTGAATGG + Intronic
1185159282 22:49213152-49213174 AACCTTAGGATGGCTGGGCATGG - Intergenic
949222416 3:1651639-1651661 CAACTTACAAGGGATGGGAAGGG - Intergenic
950612745 3:14136740-14136762 AACATTAGGAGGGCGGGGAAGGG + Intronic
950657557 3:14446017-14446039 CTGCTTAGGAGTACGGGGAAAGG + Intronic
950662750 3:14476883-14476905 CAGCTTTGGAGGATGGGGAAAGG + Intronic
951164717 3:19471090-19471112 GAGTTTAGTTGGGCTGGGAAAGG + Intronic
952054613 3:29429578-29429600 CAGCTTAGAAGCGGTGGAAATGG - Intronic
952838498 3:37624948-37624970 AAGCTAGGGAGAGCTGGGAAGGG - Intronic
952891520 3:38045146-38045168 CAGCTTAGGTAGACTGTGAAGGG + Intronic
952971519 3:38653797-38653819 CTGCTGGGGAGGGCTGGGCAAGG - Intergenic
953007719 3:38993749-38993771 GAACTTAGGTGGGCTGGGATAGG - Intergenic
953023549 3:39131290-39131312 GAGCTGTGGTGGGCTGGGAAAGG + Intronic
953078236 3:39591464-39591486 CATCTGAGGAGGGGTGGGATGGG - Intergenic
953481598 3:43256872-43256894 CAGCTAATGAGGCCTGGGATTGG + Intergenic
953899378 3:46830902-46830924 CAGCAGAGGAGGTTTGGGAAAGG - Intronic
953950881 3:47189205-47189227 CAGATAAGGAGGGCTGGGCATGG + Intergenic
953983442 3:47424290-47424312 CAGCACAGGAGGGCTGGAAGAGG + Intronic
954456779 3:50603914-50603936 CTGCCCAGGAGGGGTGGGAAGGG - Intergenic
954618051 3:51980350-51980372 CAGCTGAGGGGCACTGGGAAGGG - Intronic
955668428 3:61375678-61375700 CAGTTTAGGAGGTCTAGGCAGGG + Intergenic
955787885 3:62558985-62559007 CAGCTTATCAGAGCTGGGATGGG - Intronic
956038055 3:65117140-65117162 CAGCTTTGGAAGGCAGGGGAAGG + Intergenic
956069091 3:65428885-65428907 CAGCTGGGAAGAGCTGGGAAAGG + Intronic
959248802 3:103912354-103912376 CTGAACAGGAGGGCTGGGAAGGG - Intergenic
960907712 3:122618020-122618042 AAGTTTAAGAGGGCTGGGCATGG - Intronic
961355630 3:126338177-126338199 CAGCTTGGGAAGGCTGGGAGAGG + Intergenic
963088363 3:141459282-141459304 AAGGTTGGGTGGGCTGGGAATGG + Intergenic
963673088 3:148277221-148277243 CAGCTAAAGAGGGGTAGGAAAGG - Intergenic
965006022 3:163024684-163024706 AAGCATAGGAAGGCTTGGAAAGG - Intergenic
966498074 3:180602784-180602806 CAGCTTAGGATGGAGCGGAATGG + Intronic
967838192 3:193981779-193981801 CAGCCTTGAAGGGCTGGGATTGG - Intergenic
967844992 3:194036050-194036072 AAGCTGATGAGGGCAGGGAATGG + Intergenic
968365865 3:198184169-198184191 CAGGTTGGCAGGGCTGGGGAAGG - Intergenic
968890760 4:3367276-3367298 CTGCGTTGGAGGGCTGAGAACGG + Intronic
969191707 4:5526597-5526619 TGGCTTAGGGGGGATGGGAAGGG - Intronic
970038003 4:11761629-11761651 CAGCTGAGGTGGGCTAGGAAGGG - Intergenic
971543071 4:27846543-27846565 TAGCTTAGTATGGTTGGGAATGG + Intergenic
971583166 4:28369141-28369163 CTGCTGAGGATGGCTGGGCACGG - Intronic
973647305 4:52962529-52962551 AAGCATAGCTGGGCTGGGAATGG + Intronic
976053189 4:81031708-81031730 CAGCTGAGGAGGGCGGAGAAAGG - Intronic
976070722 4:81236584-81236606 CATTATAGGAGTGCTGGGAAGGG - Intergenic
976145957 4:82043283-82043305 GAGATAAGGAGGGCGGGGAAGGG + Intronic
977086483 4:92605100-92605122 CAGTTCAGCATGGCTGGGAAAGG - Intronic
979111143 4:116758791-116758813 CAGCTTACAAGGGATGTGAAGGG - Intergenic
979254903 4:118599327-118599349 CAGGTTGGCAGGGCTGGGGAAGG - Intergenic
979334064 4:119446692-119446714 CAGGTTGGCAGGGCTGGGCAAGG + Intergenic
980800726 4:137746224-137746246 CAAATTAGGAGGGAAGGGAAGGG - Intergenic
980841236 4:138264168-138264190 GAGCTTGGAAGGGCAGGGAAGGG - Intergenic
981403724 4:144342616-144342638 TAGTTTAGGGGGCCTGGGAAAGG + Intergenic
981598109 4:146449965-146449987 CATCAAAGGAGGGGTGGGAATGG + Intronic
981656543 4:147118331-147118353 CTGTTTAGGAGGTGTGGGAATGG + Intergenic
985155379 4:186982542-186982564 CAGCTTGGTAGAGTTGGGAAAGG + Intergenic
986199385 5:5567801-5567823 CAGCTGAGCCGGGCTGGGCAGGG - Intergenic
986356649 5:6935358-6935380 CAGGTTAGGAGGGCAGGAAGCGG - Intergenic
986581087 5:9266135-9266157 CATTTTAGGAGAGCAGGGAATGG + Intronic
988290210 5:29274713-29274735 CAGCTTACAAGGACTGTGAAGGG + Intergenic
989502954 5:42190532-42190554 CAGGTTCTGAGGTCTGGGAAGGG + Intergenic
989588754 5:43094146-43094168 CACCATAGGAAAGCTGGGAATGG - Intronic
992384184 5:76267967-76267989 CCACTTAGGAGGGCTGGGCTGGG - Intronic
995553678 5:113305249-113305271 CAACTGAGGATGGCTGGGAGAGG - Intronic
996365916 5:122701386-122701408 CAGGTCAGGATGGCTTGGAAAGG + Intergenic
996663940 5:126035924-126035946 CAGTTCAGCAAGGCTGGGAAGGG + Intergenic
996894233 5:128460289-128460311 CAACTTACGAGGGATGTGAAAGG + Intronic
997625595 5:135328700-135328722 CACCTTGGCAGGCCTGGGAATGG - Intronic
999124813 5:149239339-149239361 CACCTTCGGGGGGCTGGGGATGG - Intronic
1000184547 5:158846464-158846486 CAGCTCAGGTGGGCTGGGTAGGG - Intronic
1000945501 5:167418037-167418059 CTGCTTTGGAGAGCTGGGCACGG + Intronic
1001425890 5:171622128-171622150 TGGCTCAGGAGGGCTAGGAAAGG + Intergenic
1002075962 5:176708693-176708715 CACATTTGGAGGGCTGGGAGGGG - Intergenic
1002260809 5:177992843-177992865 CTCCTGTGGAGGGCTGGGAAGGG + Exonic
1002567482 5:180119968-180119990 CAGCCCAGGATGGCTGGGGAAGG - Intronic
1002725091 5:181289393-181289415 CAGGTTGGCAGGGCTGGGGAAGG - Intergenic
1003141598 6:3476151-3476173 CAGCTCAGGAGGACTCAGAAAGG + Intergenic
1004154685 6:13157221-13157243 GAGCTGAGGGGGGCTGGGTAGGG - Intronic
1004413980 6:15407560-15407582 CAGCTCAGGAAGACTGGGAAGGG - Intronic
1005418928 6:25629420-25629442 CAACTCAGGATGGCTGTGAAAGG + Intergenic
1006149996 6:31981991-31982013 CAGCTTAGCTGGGCTGGGGGAGG + Intronic
1006156297 6:32014729-32014751 CAGCTTAGCTGGGCTGGGGGAGG + Intergenic
1006804704 6:36780445-36780467 CAGCTAAGGAGGGATGGGATTGG - Intronic
1007546534 6:42698724-42698746 CAGCCCAGGATGGCTGGAAAGGG - Intronic
1010289662 6:74120668-74120690 CAACTTACGAGGGATGTGAAGGG + Intergenic
1010960492 6:82140588-82140610 GGGCTGAGGAGGGATGGGAAAGG + Intergenic
1011309281 6:85964207-85964229 GAGCTTGGGTGGGCAGGGAAGGG + Intergenic
1011997387 6:93609691-93609713 CAGCTGAGAAGGGATGGGATAGG - Intergenic
1013261391 6:108446799-108446821 CAGCATAAGAGAGCTGGGAGTGG - Intronic
1013287034 6:108690741-108690763 CAGCTTTGGAGGCCTGGGGCAGG - Intergenic
1014886439 6:126787294-126787316 CAGCTTAGGAGACATGGGGAAGG + Intergenic
1015695263 6:135972822-135972844 CAGCTAAGGTGGGTTGGGAGTGG + Intronic
1016507511 6:144799105-144799127 CAAATCAGGAGGGCTGGGATTGG + Intronic
1018629464 6:165809746-165809768 CCCACTAGGAGGGCTGGGAAGGG - Intronic
1018765877 6:166932378-166932400 CAGAGCAGGAGGGTTGGGAAGGG - Intronic
1019199634 6:170304031-170304053 CAGCTTAGGAGAGAGGAGAAGGG - Intronic
1019460983 7:1159134-1159156 GGGCGAAGGAGGGCTGGGAAAGG - Intronic
1019501488 7:1367028-1367050 CAGCTGAGGAGGGCAGGGCTGGG - Intergenic
1019803473 7:3105384-3105406 CAGGTCAGGAGGGCAGGGAAGGG - Intergenic
1019923046 7:4174884-4174906 CAACAGAGGAGGGGTGGGAACGG - Intronic
1021257366 7:18409522-18409544 CAGTTTCTGAGGGTTGGGAAGGG - Intronic
1021814938 7:24437779-24437801 CAGTTTACCAGGGCTGGAAAGGG + Intergenic
1023480939 7:40633711-40633733 TAGCTTAGGAGATCTGTGAAAGG + Intronic
1024069991 7:45777004-45777026 CAGGTTGGCAGGGCTGGGGAAGG - Intergenic
1024323779 7:48093074-48093096 CAGCTAAGGAGAGCTAAGAAGGG - Intronic
1025143400 7:56484076-56484098 CAGCCCAGGAGGGTTGGGCAGGG + Intergenic
1025187307 7:56871194-56871216 CAGGTTGGCAGGGCTGGGGAAGG + Intergenic
1025188726 7:56881002-56881024 CAGGTTGGCAGGGCTGGGGAAGG + Intergenic
1025683208 7:63695918-63695940 CAGGTTGGCAGGGCTGGGGAAGG - Intergenic
1025684618 7:63705726-63705748 CAGGTTGGCAGGGCTGGGGAAGG - Intergenic
1025730561 7:64103227-64103249 CAGCTTCGGGGGGCCGGGCATGG + Intronic
1025990323 7:66492436-66492458 CAGGTTGGCAGGGCTGGGGAAGG + Intergenic
1026038427 7:66846158-66846180 CAGGTTGGCAGGGCTGGGGAAGG - Intergenic
1026794883 7:73359753-73359775 CAGCGGCGAAGGGCTGGGAAAGG + Intergenic
1026936571 7:74259990-74260012 CAGCCTCGGAGGGGTGGGAGTGG + Intergenic
1027212974 7:76165428-76165450 CAGGTTGGGAGGGCTGGGGAAGG + Intergenic
1029209368 7:98893238-98893260 AAGATTAGGAGGGCTGGGCGAGG - Intronic
1031073546 7:117190179-117190201 CAGCTTGGGAGGGCAGGGCCAGG + Intronic
1032047389 7:128621292-128621314 CAGGTTGGCAGGGCTGGGGAAGG - Intergenic
1032145883 7:129380202-129380224 CAGCTTAGGAGAGAAGGCAAAGG - Intronic
1033030019 7:137817187-137817209 CAGCTGAAGAGGGGTGGGAAGGG - Intronic
1035090911 7:156309479-156309501 CAGCTGAGGATGCCTGGAAAGGG - Intergenic
1035296400 7:157869223-157869245 CAGCATGGGAGGTCTGGGTAGGG + Intronic
1035399588 7:158556261-158556283 CAGATTAGATGGGCTGGGCATGG + Intronic
1036609838 8:10340219-10340241 CAGCTTGGGAGACCTGAGAATGG - Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1037932711 8:22891771-22891793 CAGCTTAAGAAGCCAGGGAAGGG + Intronic
1038027852 8:23608209-23608231 CAACTTAGGATGGCTCTGAAGGG - Intergenic
1038479280 8:27890677-27890699 CAGGGTGGGAGGGGTGGGAAAGG + Intronic
1039065584 8:33604790-33604812 CAGCCCAGGAGGGATGGGCATGG - Intergenic
1039437894 8:37573189-37573211 CAGATTATCAAGGCTGGGAATGG + Intergenic
1039716458 8:40114688-40114710 CACTTTAGGAGGCCTGGGACGGG - Intergenic
1039999871 8:42566807-42566829 CAGCCTAGGAGGACAGGCAAGGG - Intergenic
1040938552 8:52808122-52808144 ATGCTTAGGAGGTCTGGGGAGGG - Intergenic
1041171555 8:55147607-55147629 CAGATTTAGAGGCCTGGGAAAGG - Intronic
1041195722 8:55399757-55399779 CTACATAGGAGGGCTGGGCAAGG + Intronic
1042611268 8:70603944-70603966 AGGCTTAGGAGGCCTGGAAATGG - Intronic
1043335973 8:79177543-79177565 CAGTTTAGCATGGCTGGGGAGGG - Intergenic
1048799303 8:138181489-138181511 CAGGTTGGTATGGCTGGGAACGG - Intronic
1049194224 8:141307086-141307108 GGGCTAGGGAGGGCTGGGAAGGG - Intronic
1049742820 8:144249178-144249200 CACCCGAGGAGGGCTGGGCAGGG - Intronic
1050268163 9:3913122-3913144 CAGCTTAGGAAGTGTGGGGAGGG + Intronic
1052766016 9:32641522-32641544 CAGGATAGGAGGGGAGGGAACGG + Intergenic
1052917341 9:33933478-33933500 CAGCTTAGCAGGTATGGGGAAGG - Exonic
1053114118 9:35487266-35487288 CAGCTGAGGAGAGCTGGTCAGGG - Intergenic
1056815622 9:89798880-89798902 AAGTTAAGGAGGGCTGGAAAGGG + Intergenic
1057003023 9:91530397-91530419 CCCCTTTGGAGGGCTGGGGAGGG + Intergenic
1058527818 9:105877969-105877991 CAACTGAGCAGAGCTGGGAATGG + Intergenic
1060534446 9:124373018-124373040 CAGCTTTGGAGAGGTAGGAAGGG - Intronic
1060813619 9:126623691-126623713 CAGCCTGGGAGGGGTGGGGAGGG + Intronic
1062616245 9:137397310-137397332 CAGCTTAGGAGGCTTGAGAAAGG + Intronic
1062750235 9:138247036-138247058 CAGGTTGGCAGGGCTGGGGAAGG - Intergenic
1203734327 Un_GL000216v2:121480-121502 CAACTAAGGACGGCTGGGACTGG + Intergenic
1187092983 X:16117092-16117114 GAGCTTGGGCTGGCTGGGAAAGG + Intergenic
1187462765 X:19502491-19502513 CAGTTTAGCATGGCTGGGGAGGG - Intronic
1187501170 X:19839919-19839941 CACCTTTGTTGGGCTGGGAACGG - Intronic
1187978701 X:24731611-24731633 CAACTCAGGGGGTCTGGGAATGG + Intronic
1189181249 X:39006652-39006674 CGGCTCAGTAGGTCTGGGAAAGG + Intergenic
1189232653 X:39464490-39464512 CTGCTTAAGAGGACTGGGAGGGG + Intergenic
1189287196 X:39860231-39860253 CAGCTAAGAAGTGGTGGGAAAGG - Intergenic
1190879631 X:54483314-54483336 CAGCCTAGGGGAGCAGGGAAGGG + Intronic
1192184812 X:68939780-68939802 CAGCTTGGGTGGGGTGGGACGGG + Intergenic
1192191607 X:68994538-68994560 CAGGTTGGCAGGGCTGGGGAAGG - Intergenic
1193236375 X:79112745-79112767 AAGCTGAGGAAGGCAGGGAATGG - Intergenic
1193328599 X:80210827-80210849 AAGCTCAGGAGTGATGGGAATGG - Intergenic
1199452272 X:147990220-147990242 CAGCTTCGCTTGGCTGGGAAAGG + Intronic
1200327813 X:155260881-155260903 CAATCCAGGAGGGCTGGGAAGGG - Exonic