ID: 915849956

View in Genome Browser
Species Human (GRCh38)
Location 1:159310743-159310765
Sequence TGTCTTCCATTGGCCACCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915849956_915849962 19 Left 915849956 1:159310743-159310765 CCACTGGTGGCCAATGGAAGACA No data
Right 915849962 1:159310785-159310807 AGAGTGGAGACTCAGACAAATGG No data
915849956_915849958 3 Left 915849956 1:159310743-159310765 CCACTGGTGGCCAATGGAAGACA No data
Right 915849958 1:159310769-159310791 TCCTGTGACCACCTTCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915849956 Original CRISPR TGTCTTCCATTGGCCACCAG TGG (reversed) Intergenic