ID: 915859021

View in Genome Browser
Species Human (GRCh38)
Location 1:159422454-159422476
Sequence GCACACTTTTAAGTGCCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915859021_915859026 6 Left 915859021 1:159422454-159422476 CCTTGGGGCACTTAAAAGTGTGC No data
Right 915859026 1:159422483-159422505 CCCTCCGCAGGTGAGATGCAGGG No data
915859021_915859028 7 Left 915859021 1:159422454-159422476 CCTTGGGGCACTTAAAAGTGTGC No data
Right 915859028 1:159422484-159422506 CCTCCGCAGGTGAGATGCAGGGG No data
915859021_915859022 -6 Left 915859021 1:159422454-159422476 CCTTGGGGCACTTAAAAGTGTGC No data
Right 915859022 1:159422471-159422493 GTGTGCAGCCATCCCTCCGCAGG No data
915859021_915859024 5 Left 915859021 1:159422454-159422476 CCTTGGGGCACTTAAAAGTGTGC No data
Right 915859024 1:159422482-159422504 TCCCTCCGCAGGTGAGATGCAGG No data
915859021_915859030 20 Left 915859021 1:159422454-159422476 CCTTGGGGCACTTAAAAGTGTGC No data
Right 915859030 1:159422497-159422519 GATGCAGGGGTCTCTGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915859021 Original CRISPR GCACACTTTTAAGTGCCCCA AGG (reversed) Intergenic
No off target data available for this crispr