ID: 915859022

View in Genome Browser
Species Human (GRCh38)
Location 1:159422471-159422493
Sequence GTGTGCAGCCATCCCTCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915859021_915859022 -6 Left 915859021 1:159422454-159422476 CCTTGGGGCACTTAAAAGTGTGC No data
Right 915859022 1:159422471-159422493 GTGTGCAGCCATCCCTCCGCAGG No data
915859016_915859022 30 Left 915859016 1:159422418-159422440 CCTGCAATGGAGGCAGCTGCGAG No data
Right 915859022 1:159422471-159422493 GTGTGCAGCCATCCCTCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915859022 Original CRISPR GTGTGCAGCCATCCCTCCGC AGG Intergenic
No off target data available for this crispr