ID: 915859026 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:159422483-159422505 |
| Sequence | CCCTCCGCAGGTGAGATGCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 915859021_915859026 | 6 | Left | 915859021 | 1:159422454-159422476 | CCTTGGGGCACTTAAAAGTGTGC | No data | ||
| Right | 915859026 | 1:159422483-159422505 | CCCTCCGCAGGTGAGATGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 915859026 | Original CRISPR | CCCTCCGCAGGTGAGATGCA GGG | Intergenic | ||