ID: 915859028

View in Genome Browser
Species Human (GRCh38)
Location 1:159422484-159422506
Sequence CCTCCGCAGGTGAGATGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915859021_915859028 7 Left 915859021 1:159422454-159422476 CCTTGGGGCACTTAAAAGTGTGC No data
Right 915859028 1:159422484-159422506 CCTCCGCAGGTGAGATGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915859028 Original CRISPR CCTCCGCAGGTGAGATGCAG GGG Intergenic
No off target data available for this crispr