ID: 915859030

View in Genome Browser
Species Human (GRCh38)
Location 1:159422497-159422519
Sequence GATGCAGGGGTCTCTGCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915859025_915859030 -9 Left 915859025 1:159422483-159422505 CCCTCCGCAGGTGAGATGCAGGG No data
Right 915859030 1:159422497-159422519 GATGCAGGGGTCTCTGCCCATGG No data
915859021_915859030 20 Left 915859021 1:159422454-159422476 CCTTGGGGCACTTAAAAGTGTGC No data
Right 915859030 1:159422497-159422519 GATGCAGGGGTCTCTGCCCATGG No data
915859023_915859030 -5 Left 915859023 1:159422479-159422501 CCATCCCTCCGCAGGTGAGATGC No data
Right 915859030 1:159422497-159422519 GATGCAGGGGTCTCTGCCCATGG No data
915859027_915859030 -10 Left 915859027 1:159422484-159422506 CCTCCGCAGGTGAGATGCAGGGG No data
Right 915859030 1:159422497-159422519 GATGCAGGGGTCTCTGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915859030 Original CRISPR GATGCAGGGGTCTCTGCCCA TGG Intergenic
No off target data available for this crispr