ID: 915859087

View in Genome Browser
Species Human (GRCh38)
Location 1:159422812-159422834
Sequence GTGAAAATGAGGACCACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915859078_915859087 10 Left 915859078 1:159422779-159422801 CCTTTCCTATGGCTAGAGTTGTA No data
Right 915859087 1:159422812-159422834 GTGAAAATGAGGACCACTGGGGG No data
915859080_915859087 5 Left 915859080 1:159422784-159422806 CCTATGGCTAGAGTTGTAGGAGT No data
Right 915859087 1:159422812-159422834 GTGAAAATGAGGACCACTGGGGG No data
915859076_915859087 28 Left 915859076 1:159422761-159422783 CCTTACTAGGGTTGAGCTCCTTT No data
Right 915859087 1:159422812-159422834 GTGAAAATGAGGACCACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915859087 Original CRISPR GTGAAAATGAGGACCACTGG GGG Intergenic
No off target data available for this crispr