ID: 915860043

View in Genome Browser
Species Human (GRCh38)
Location 1:159434465-159434487
Sequence CACTCAGCACAACCCCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915860040_915860043 11 Left 915860040 1:159434431-159434453 CCTTTTCATAAAATACTTTGGTG No data
Right 915860043 1:159434465-159434487 CACTCAGCACAACCCCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915860043 Original CRISPR CACTCAGCACAACCCCAAAG AGG Intergenic
No off target data available for this crispr