ID: 915862575

View in Genome Browser
Species Human (GRCh38)
Location 1:159461728-159461750
Sequence CTCATTACTGCTGGGTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915862562_915862575 7 Left 915862562 1:159461698-159461720 CCCCATCCCAGCAGGGGAGGAGC No data
Right 915862575 1:159461728-159461750 CTCATTACTGCTGGGTGGAGTGG No data
915862563_915862575 6 Left 915862563 1:159461699-159461721 CCCATCCCAGCAGGGGAGGAGCT No data
Right 915862575 1:159461728-159461750 CTCATTACTGCTGGGTGGAGTGG No data
915862557_915862575 17 Left 915862557 1:159461688-159461710 CCTCTTCTGACCCCATCCCAGCA No data
Right 915862575 1:159461728-159461750 CTCATTACTGCTGGGTGGAGTGG No data
915862568_915862575 0 Left 915862568 1:159461705-159461727 CCAGCAGGGGAGGAGCTGGGCCC No data
Right 915862575 1:159461728-159461750 CTCATTACTGCTGGGTGGAGTGG No data
915862564_915862575 5 Left 915862564 1:159461700-159461722 CCATCCCAGCAGGGGAGGAGCTG No data
Right 915862575 1:159461728-159461750 CTCATTACTGCTGGGTGGAGTGG No data
915862567_915862575 1 Left 915862567 1:159461704-159461726 CCCAGCAGGGGAGGAGCTGGGCC No data
Right 915862575 1:159461728-159461750 CTCATTACTGCTGGGTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915862575 Original CRISPR CTCATTACTGCTGGGTGGAG TGG Intergenic
No off target data available for this crispr