ID: 915866156

View in Genome Browser
Species Human (GRCh38)
Location 1:159501188-159501210
Sequence GGAGAGTGCTTGAGTAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915866156_915866158 18 Left 915866156 1:159501188-159501210 CCTGTTTTACTCAAGCACTCTCC No data
Right 915866158 1:159501229-159501251 AATGTGATTGTTTATTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915866156 Original CRISPR GGAGAGTGCTTGAGTAAAAC AGG (reversed) Intergenic
No off target data available for this crispr