ID: 915868986

View in Genome Browser
Species Human (GRCh38)
Location 1:159537874-159537896
Sequence TATGGTAGTGCTGCAAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915868986 Original CRISPR TATGGTAGTGCTGCAAGTGC AGG Intergenic
903671152 1:25036196-25036218 TGTGGTAGTGATGGTAGTGCTGG - Intergenic
910734502 1:90437763-90437785 TATGCTATTGTTGCAAGTGTTGG + Intergenic
911906344 1:103573099-103573121 TCTGGTAATGCTGTGAGTGCAGG + Exonic
911912915 1:103657830-103657852 TGTGGTAATGCTGTGAGTGCAGG + Exonic
911915540 1:103694118-103694140 TGTGGTAATGCTGTGAGTGCAGG - Exonic
911920327 1:103751969-103751991 TGTGGTAATGCTGTGAGTGCAGG + Exonic
915868986 1:159537874-159537896 TATGGTAGTGCTGCAAGTGCAGG + Intergenic
919346301 1:196383760-196383782 TATAGCATTTCTGCAAGTGCTGG - Intronic
1067929300 10:50543979-50544001 TTTGGTAGTGCTGCCCATGCCGG - Intronic
1069415338 10:68195636-68195658 GATGCTAGTGCTGCAAGTGAAGG - Intronic
1070696169 10:78564829-78564851 CAAGGTATTGCTGCAACTGCGGG - Intergenic
1072012733 10:91317788-91317810 TATGGTATTGCCTCATGTGCTGG + Intergenic
1074483837 10:113854232-113854254 TCTGGGAGTGCTGAAAGTGCGGG - Intronic
1075533781 10:123253635-123253657 TATGTGAGTGCTGCAGATGCTGG + Intergenic
1078562096 11:12381104-12381126 TATGGTATTTCTGCAAGCCCAGG + Intronic
1080800000 11:35601557-35601579 GATGGTAGTGCTGAGAGTGTGGG - Intergenic
1082930857 11:58603623-58603645 GAGGGTAGAGCTGCAAATGCTGG + Intronic
1087401610 11:97674031-97674053 TTTGACAGTGCTGCAAGTCCTGG + Intergenic
1089656080 11:119947931-119947953 AATGGTAGAGTTGCAACTGCAGG + Intergenic
1097567807 12:61293239-61293261 TATGCTAATGCTGCTAGTCCAGG + Intergenic
1098477505 12:70921708-70921730 TGTGGTGGTGGTGCAAGTGGAGG - Intergenic
1100967893 12:100032992-100033014 TAAGCTAGGGGTGCAAGTGCAGG + Intronic
1101834496 12:108285982-108286004 CATGTTAATGCTGCAATTGCAGG - Intergenic
1105661632 13:22502443-22502465 TCTGGTACTGCTCTAAGTGCTGG + Intergenic
1107425013 13:40283879-40283901 TATGCTCATGCTGCATGTGCAGG + Intergenic
1110154790 13:72303207-72303229 CATGGTAGTAATGCAATTGCTGG - Intergenic
1111784108 13:92765606-92765628 GATGGTAATGCTGCTAGTCCTGG - Intronic
1121381076 14:93467684-93467706 TATGATATTCCTGCAAGTACCGG - Exonic
1122391784 14:101394354-101394376 TATGGCAGTGCTGCCGGTGAGGG - Intergenic
1122728344 14:103776119-103776141 TCTGGTACAGCTGCAAGAGCTGG + Intronic
1126073356 15:44885363-44885385 TTTGGTAGTGGTGGCAGTGCTGG + Intergenic
1127778948 15:62294682-62294704 GATGGTAGGGCTGCATGTGTTGG - Intergenic
1128352757 15:66902043-66902065 GATCGTATTGATGCAAGTGCGGG - Intergenic
1131678632 15:94698480-94698502 TAAGGTAGGGCTGCTAGTGGGGG + Intergenic
1137061531 16:35795150-35795172 TATGGGAGTGTTGCAAGTGTCGG - Intergenic
1140104847 16:71950442-71950464 GATGGTAGTACTGCAAATGTGGG - Intronic
1145728173 17:27153118-27153140 TGTGGGAGTGTTGCAAGTGATGG - Intergenic
1153045164 18:849175-849197 GATGGCAGGACTGCAAGTGCTGG - Intergenic
1156418823 18:36928185-36928207 TATGGTGGTGGTGATAGTGCTGG + Intronic
1166896106 19:46022769-46022791 TGTGGTAGTGCTGCACATTCCGG + Exonic
1167766475 19:51486170-51486192 GATGGTAGTGTTGCTAGTGATGG + Intronic
929567636 2:42999742-42999764 TCTGGTAAGGCTGGAAGTGCAGG + Intergenic
930243446 2:48959381-48959403 TATCTTAGTGATGCAAGTGCAGG + Intergenic
939568158 2:143809269-143809291 TATGGTGGTGGTGCTATTGCTGG - Intergenic
942906584 2:181189028-181189050 TTTGGTAGGGCTCCATGTGCTGG - Intergenic
1178104260 21:29300082-29300104 TTGGGTAGTGGTGCAAGGGCTGG + Intronic
1178449868 21:32688123-32688145 GGTGGTAGTGCTGGAAGTGTGGG - Intronic
1179188069 21:39100041-39100063 TGAGGTAGTGATGCTAGTGCTGG + Intergenic
1182843207 22:33409089-33409111 TATGGGACTGCTCCAAGTGAAGG - Intronic
1185060694 22:48605063-48605085 TATGGTGTTGCTGCTAGTGATGG + Intronic
950687466 3:14628818-14628840 TAAGGCAGGGATGCAAGTGCAGG + Intergenic
953704464 3:45220675-45220697 TATGGCAGTGCTGAAAGTCGTGG + Intergenic
953983937 3:47427161-47427183 CATGGTAGTGCTGGAAGACCAGG + Exonic
964200468 3:154113413-154113435 TATGGTAGTTCTATAAGTACCGG + Intergenic
964851636 3:161102386-161102408 TAGGGTAGGGCCCCAAGTGCTGG - Intronic
974611144 4:64218131-64218153 TTTGGTAGTGCCGCAGGGGCAGG - Intergenic
975625137 4:76338173-76338195 TAAGGCAGTGATGCTAGTGCTGG + Intronic
978549664 4:109911917-109911939 TGAGGTAGTGTTCCAAGTGCTGG - Intergenic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
987886666 5:23822314-23822336 AATGGTAGTGATGCAAGACCAGG + Intergenic
994176636 5:96718818-96718840 TATGGGAGTGCTGCCAGTGATGG + Intronic
996177277 5:120374515-120374537 TATGGTATTGCTGCAAATTCAGG - Intergenic
1001100007 5:168806511-168806533 GATGTTATTGCTGCACGTGCAGG + Exonic
1005819192 6:29583237-29583259 CATGGATGTGCTGCAAGTCCAGG - Intronic
1006230959 6:32586380-32586402 TATGATAGAGAAGCAAGTGCTGG - Intronic
1018622383 6:165742914-165742936 TGAGCAAGTGCTGCAAGTGCTGG - Intronic
1023127441 7:36969527-36969549 TAGGGAAGTGATGCAAGTGGGGG - Intronic
1027607075 7:80313841-80313863 TATAGTAGAGCAGTAAGTGCTGG + Intergenic
1035010988 7:155714785-155714807 TAAGGTAGTAGTTCAAGTGCAGG + Intronic
1035046868 7:155973569-155973591 CATGGTGGTCCTGCCAGTGCTGG + Intergenic
1045702914 8:104887235-104887257 TAGGGTAATGAAGCAAGTGCTGG + Intronic
1046115884 8:109782530-109782552 TATGGTAAAGCAGCAAGTTCAGG + Intergenic
1057925940 9:99148992-99149014 TAGGGTACTGGTGCCAGTGCTGG - Intronic
1194877976 X:99213118-99213140 GATTCTATTGCTGCAAGTGCGGG + Intergenic
1196322150 X:114354020-114354042 TATGGTAGTGGTGCAGCAGCAGG + Intergenic
1197407677 X:126072859-126072881 TATGGTAGTGCTATAAATTCAGG + Intergenic
1200700070 Y:6394651-6394673 TGTGGGAGTGCTGCAAGTGTTGG - Intergenic
1200766911 Y:7087894-7087916 TATGGTGGAGCTGCAGGAGCTGG - Intronic
1200912918 Y:8546863-8546885 TGTGGGAGTGTTGCAAGTGTTGG + Intergenic
1200926613 Y:8660296-8660318 TGTGGGAGTGCTGCGAGTGTTGG + Intergenic
1200930866 Y:8695989-8696011 TGTGGGAGTGGTGCAAGTGTTGG - Intergenic
1201034041 Y:9770047-9770069 TGTGGGAGTGCTGCAAGTGTTGG + Intergenic
1201735969 Y:17262055-17262077 TCTGGTAGTAATGCAAGTGATGG + Intergenic