ID: 915870998

View in Genome Browser
Species Human (GRCh38)
Location 1:159559448-159559470
Sequence TAATTCCCACATATCGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915870998_915871002 -2 Left 915870998 1:159559448-159559470 CCTCCCTCGATATGTGGGAATTA No data
Right 915871002 1:159559469-159559491 TACAATTTGAGATGAGATTTGGG 0: 698
1: 2205
2: 9622
3: 11947
4: 8768
915870998_915871005 3 Left 915870998 1:159559448-159559470 CCTCCCTCGATATGTGGGAATTA No data
Right 915871005 1:159559474-159559496 TTTGAGATGAGATTTGGGTGGGG 0: 636
1: 1979
2: 10095
3: 12822
4: 9433
915870998_915871003 1 Left 915870998 1:159559448-159559470 CCTCCCTCGATATGTGGGAATTA No data
Right 915871003 1:159559472-159559494 AATTTGAGATGAGATTTGGGTGG 0: 639
1: 2054
2: 10290
3: 12845
4: 9442
915870998_915871004 2 Left 915870998 1:159559448-159559470 CCTCCCTCGATATGTGGGAATTA No data
Right 915871004 1:159559473-159559495 ATTTGAGATGAGATTTGGGTGGG 0: 673
1: 1973
2: 10309
3: 12710
4: 10112
915870998_915871001 -3 Left 915870998 1:159559448-159559470 CCTCCCTCGATATGTGGGAATTA No data
Right 915871001 1:159559468-159559490 TTACAATTTGAGATGAGATTTGG 0: 683
1: 2082
2: 4985
3: 11931
4: 12250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915870998 Original CRISPR TAATTCCCACATATCGAGGG AGG (reversed) Intergenic
No off target data available for this crispr