ID: 915871186

View in Genome Browser
Species Human (GRCh38)
Location 1:159561226-159561248
Sequence ATTGTTCTCCAGGGCTTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915871186_915871192 12 Left 915871186 1:159561226-159561248 CCAATGAAGCCCTGGAGAACAAT No data
Right 915871192 1:159561261-159561283 GTCCTAGGATAAATGTCCAGTGG No data
915871186_915871193 13 Left 915871186 1:159561226-159561248 CCAATGAAGCCCTGGAGAACAAT No data
Right 915871193 1:159561262-159561284 TCCTAGGATAAATGTCCAGTGGG No data
915871186_915871191 -3 Left 915871186 1:159561226-159561248 CCAATGAAGCCCTGGAGAACAAT No data
Right 915871191 1:159561246-159561268 AATGGATATATTGGTGTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915871186 Original CRISPR ATTGTTCTCCAGGGCTTCAT TGG (reversed) Intergenic
No off target data available for this crispr