ID: 915878900

View in Genome Browser
Species Human (GRCh38)
Location 1:159644258-159644280
Sequence CCTTTTAAGGGGATCATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915878894_915878900 -2 Left 915878894 1:159644237-159644259 CCTGAGGAGTTCTTGGCTGTGCC No data
Right 915878900 1:159644258-159644280 CCTTTTAAGGGGATCATGGAAGG No data
915878893_915878900 -1 Left 915878893 1:159644236-159644258 CCCTGAGGAGTTCTTGGCTGTGC No data
Right 915878900 1:159644258-159644280 CCTTTTAAGGGGATCATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915878900 Original CRISPR CCTTTTAAGGGGATCATGGA AGG Intergenic
No off target data available for this crispr