ID: 915880371

View in Genome Browser
Species Human (GRCh38)
Location 1:159664796-159664818
Sequence GTTCAGCAGCACCATGCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915880371_915880374 5 Left 915880371 1:159664796-159664818 CCTACTGCATGGTGCTGCTGAAC No data
Right 915880374 1:159664824-159664846 CTCTGATTTGGTGTCTCCTTTGG 0: 11
1: 26
2: 68
3: 88
4: 243
915880371_915880372 -7 Left 915880371 1:159664796-159664818 CCTACTGCATGGTGCTGCTGAAC No data
Right 915880372 1:159664812-159664834 GCTGAACAGCCACTCTGATTTGG 0: 21
1: 71
2: 56
3: 63
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915880371 Original CRISPR GTTCAGCAGCACCATGCAGT AGG (reversed) Intergenic
No off target data available for this crispr