ID: 915880371

View in Genome Browser
Species Human (GRCh38)
Location 1:159664796-159664818
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915880371_915880372 -7 Left 915880371 1:159664796-159664818 CCTACTGCATGGTGCTGCTGAAC No data
Right 915880372 1:159664812-159664834 GCTGAACAGCCACTCTGATTTGG No data
915880371_915880374 5 Left 915880371 1:159664796-159664818 CCTACTGCATGGTGCTGCTGAAC No data
Right 915880374 1:159664824-159664846 CTCTGATTTGGTGTCTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915880371 Original CRISPR GTTCAGCAGCACCATGCAGT AGG (reversed) Intergenic