ID: 915880372

View in Genome Browser
Species Human (GRCh38)
Location 1:159664812-159664834
Sequence GCTGAACAGCCACTCTGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915880369_915880372 8 Left 915880369 1:159664781-159664803 CCATGGAATGTACTTCCTACTGC No data
Right 915880372 1:159664812-159664834 GCTGAACAGCCACTCTGATTTGG No data
915880368_915880372 9 Left 915880368 1:159664780-159664802 CCCATGGAATGTACTTCCTACTG No data
Right 915880372 1:159664812-159664834 GCTGAACAGCCACTCTGATTTGG No data
915880371_915880372 -7 Left 915880371 1:159664796-159664818 CCTACTGCATGGTGCTGCTGAAC No data
Right 915880372 1:159664812-159664834 GCTGAACAGCCACTCTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915880372 Original CRISPR GCTGAACAGCCACTCTGATT TGG Intergenic