ID: 915885007

View in Genome Browser
Species Human (GRCh38)
Location 1:159713041-159713063
Sequence CAGTCTCAGAATCAGGACAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 188}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915885007_915885015 20 Left 915885007 1:159713041-159713063 CCAGTGTCCTGATTCTGAGACTG 0: 1
1: 0
2: 2
3: 20
4: 188
Right 915885015 1:159713084-159713106 CAATGCCCTCCTGCTTTCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 237
915885007_915885019 27 Left 915885007 1:159713041-159713063 CCAGTGTCCTGATTCTGAGACTG 0: 1
1: 0
2: 2
3: 20
4: 188
Right 915885019 1:159713091-159713113 CTCCTGCTTTCTGGGGGTCATGG 0: 1
1: 0
2: 2
3: 39
4: 340
915885007_915885014 19 Left 915885007 1:159713041-159713063 CCAGTGTCCTGATTCTGAGACTG 0: 1
1: 0
2: 2
3: 20
4: 188
Right 915885014 1:159713083-159713105 GCAATGCCCTCCTGCTTTCTGGG 0: 1
1: 0
2: 0
3: 20
4: 287
915885007_915885010 -3 Left 915885007 1:159713041-159713063 CCAGTGTCCTGATTCTGAGACTG 0: 1
1: 0
2: 2
3: 20
4: 188
Right 915885010 1:159713061-159713083 CTGAAGAGCCCTGTGAATGTGGG 0: 1
1: 0
2: 2
3: 17
4: 182
915885007_915885013 18 Left 915885007 1:159713041-159713063 CCAGTGTCCTGATTCTGAGACTG 0: 1
1: 0
2: 2
3: 20
4: 188
Right 915885013 1:159713082-159713104 GGCAATGCCCTCCTGCTTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 153
915885007_915885009 -4 Left 915885007 1:159713041-159713063 CCAGTGTCCTGATTCTGAGACTG 0: 1
1: 0
2: 2
3: 20
4: 188
Right 915885009 1:159713060-159713082 ACTGAAGAGCCCTGTGAATGTGG 0: 1
1: 0
2: 5
3: 20
4: 229
915885007_915885020 28 Left 915885007 1:159713041-159713063 CCAGTGTCCTGATTCTGAGACTG 0: 1
1: 0
2: 2
3: 20
4: 188
Right 915885020 1:159713092-159713114 TCCTGCTTTCTGGGGGTCATGGG 0: 1
1: 2
2: 0
3: 15
4: 198
915885007_915885016 21 Left 915885007 1:159713041-159713063 CCAGTGTCCTGATTCTGAGACTG 0: 1
1: 0
2: 2
3: 20
4: 188
Right 915885016 1:159713085-159713107 AATGCCCTCCTGCTTTCTGGGGG 0: 1
1: 0
2: 4
3: 19
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915885007 Original CRISPR CAGTCTCAGAATCAGGACAC TGG (reversed) Exonic
900259307 1:1715888-1715910 CAGTCTGGAAATCGGGACACTGG - Intronic
903470408 1:23582932-23582954 CAGTGTCAGAATCAGGAACCAGG + Intronic
905828848 1:41048134-41048156 CTGAAACAGAATCAGGACACAGG + Intronic
906088343 1:43155732-43155754 CAGTCTCAGTACTGGGACACTGG + Intronic
907133174 1:52115456-52115478 CAGACTCTGAATCTGGAAACTGG - Intergenic
914945237 1:152059739-152059761 CAATCTCAGGTTCAGGACTCAGG + Intergenic
914990823 1:152498205-152498227 AAGACTCAGAAACAGGGCACTGG + Intergenic
915028605 1:152856584-152856606 GGGTCTCAGAATCAGGGCATTGG - Intergenic
915841908 1:159220161-159220183 CTGTCTAAGAACCAGGAAACTGG - Intergenic
915885007 1:159713041-159713063 CAGTCTCAGAATCAGGACACTGG - Exonic
922743714 1:228031166-228031188 CAGGCTCAGAGTCCGGGCACTGG + Intronic
1063236854 10:4126278-4126300 CAGTCACTGAATGAGGAGACAGG - Intergenic
1063504162 10:6580610-6580632 CATTCTCAGAGTCAGGAAAAGGG + Intergenic
1064436704 10:15317108-15317130 CAGTCACGGAAACAGGACACAGG + Intronic
1064615518 10:17151401-17151423 CAGTCACAGAACCAGGACAGAGG + Intronic
1065898137 10:30182471-30182493 CACTGTAAGACTCAGGACACGGG + Intergenic
1066226689 10:33390134-33390156 CAGGCACAGAATCTGGAGACAGG + Intergenic
1067052809 10:43032886-43032908 GAGTCTCAGAATGAGGAGAGAGG + Intergenic
1069028805 10:63573439-63573461 CATTCTTAGAATAAGAACACTGG - Intronic
1069835224 10:71303953-71303975 CAGTCTCAGACCCAGCCCACAGG - Intergenic
1070765412 10:79053495-79053517 GAGTCTGAGAATTAGGACCCTGG - Intergenic
1071194347 10:83140354-83140376 CAATGTCAGAATCAGAAAACAGG - Intergenic
1072249825 10:93572689-93572711 CACTCCCTGAATCAGGGCACAGG - Intronic
1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG + Intergenic
1073066561 10:100763360-100763382 CAGGCTCAGAATCAACACATTGG + Intronic
1073922701 10:108477995-108478017 CAGTGTCAGCATCAGAACAAGGG - Intergenic
1074711786 10:116183876-116183898 CAGTCTCACTATCAGGACCTGGG + Intronic
1075699054 10:124456758-124456780 CAGTGTCAGAAACACCACACGGG - Intergenic
1077758772 11:5066888-5066910 TGGTCTCAGAACCAGGACATGGG + Intergenic
1079046756 11:17111285-17111307 CAGTATCACAATCAGGATATTGG - Intronic
1079392060 11:20031084-20031106 CTGTTTCAGGACCAGGACACAGG + Intronic
1081295932 11:41389337-41389359 CAGTCTCAGAATCAGAATCAGGG - Intronic
1081962704 11:47150090-47150112 CAGTCTAAAAACCAGGATACTGG - Intronic
1082270161 11:50161951-50161973 CAGTATCAGGATTAGAACACAGG + Intergenic
1082792317 11:57354922-57354944 CAGGGCCAGAAACAGGACACTGG + Intronic
1084171853 11:67404743-67404765 CAGACTCAAACTCAGGACTCTGG + Intronic
1085039268 11:73317444-73317466 CGGTCTGGGAGTCAGGACACTGG - Intronic
1085533039 11:77202946-77202968 CACTCTCAGCCTCTGGACACAGG + Intronic
1090409171 11:126495787-126495809 CAGCCTGAGGATCAGGACACTGG + Intronic
1090476285 11:127024246-127024268 CAGATTCAGAATCAGAACCCAGG - Intergenic
1090665778 11:128914140-128914162 CAGGGTCAGAATCAGGACACAGG + Intronic
1090839607 11:130476642-130476664 CAGTCACAGAGGCAGGACACAGG - Intergenic
1091710143 12:2734109-2734131 CAGTCTCAGACTCAGGGGAAGGG + Intergenic
1092490943 12:8944474-8944496 CAGTCACAGGATTAGGAAACAGG + Intronic
1094597108 12:31875431-31875453 CAGTCTTGGAGTCAGGAGACAGG + Intergenic
1095887919 12:47208106-47208128 GAGTCACAGAATCAAGACCCTGG - Intronic
1097314966 12:58162068-58162090 CTGTAACAAAATCAGGACACAGG + Intergenic
1097762180 12:63479416-63479438 GAGGCTCAGATTCAGGAAACAGG - Intergenic
1100413468 12:94346585-94346607 CAGTCTCACTTTCAGGACTCTGG - Intronic
1100855564 12:98754432-98754454 TAGTCTCACAATGAAGACACAGG + Intronic
1101208494 12:102512976-102512998 CACTCTCAGAATCAGGGTCCTGG - Intergenic
1101988897 12:109468426-109468448 CAGTCTCAGAAACAGGAAGGCGG + Intronic
1104162839 12:126197279-126197301 CAGTATCAACATCAGGAAACTGG - Intergenic
1104228362 12:126859288-126859310 CAGTGTCAGAACTGGGACACAGG - Intergenic
1105739095 13:23303458-23303480 CATGTTCAGAATCAGGGCACAGG + Intronic
1106360832 13:29029139-29029161 CAGGCCCAGAGTCAGAACACAGG - Intronic
1106696089 13:32174536-32174558 CAGTCTCAGTATCTGTACAATGG - Intronic
1107360472 13:39611966-39611988 CAGTCTCAGAATTTGAACTCAGG - Intergenic
1113752890 13:112788527-112788549 GAGTCTACGCATCAGGACACCGG - Intronic
1113871534 13:113562769-113562791 CAATCCCAGAATCAGGTCACTGG - Intergenic
1115725119 14:36205920-36205942 CAGGCTCAGAATCAGATCAAAGG + Intergenic
1115952912 14:38741446-38741468 CAGTCTCAGTATCAAAACAAAGG + Intergenic
1118102533 14:62622993-62623015 CAGTCACAGAATCTGAACTCAGG + Intergenic
1123058483 14:105583699-105583721 CAGACTCTGAATGAGGAGACGGG - Intergenic
1123082816 14:105703932-105703954 CAGACTCTGAATGAGGAGACGGG - Intergenic
1123163969 14:106308100-106308122 CAGTCTGAAAAACAGGACACTGG + Intergenic
1123866344 15:24523231-24523253 AAGTCTCAGAATGAGGAAAGCGG + Intergenic
1125711396 15:41789890-41789912 CAGTTTCTGAAACAGCACACAGG - Intronic
1127004831 15:54557098-54557120 CAGTCTCAGACACCAGACACCGG + Intronic
1127703865 15:61528099-61528121 CAGTCTCAGGACCAGGACCCGGG + Intergenic
1128063740 15:64751407-64751429 AATTCGCAGAACCAGGACACGGG + Intronic
1128065711 15:64763232-64763254 AAGGCTCTGAATAAGGACACAGG + Intronic
1128514693 15:68335020-68335042 CAGTCAGAGACTCAGGAGACAGG + Intronic
1130099934 15:80885610-80885632 CAGACTCAAACTCAGGCCACTGG - Intronic
1130108402 15:80945823-80945845 CAGTGGCAGACTCAGCACACTGG - Intronic
1130235766 15:82132214-82132236 CTGCCTCAGCACCAGGACACAGG - Intronic
1131445002 15:92491184-92491206 CAGTCTAAGGGTCAGGACACTGG + Intronic
1135204394 16:20470572-20470594 AAGGCTCAAAATCAGGACACTGG + Intronic
1135648593 16:24185810-24185832 CAGTCTCTGAACCAGCACAGGGG + Intronic
1137053219 16:35730543-35730565 CAGTCTAACGATAAGGACACTGG - Intergenic
1139219069 16:65160525-65160547 CAGCATCAGAATCAGAACTCAGG + Intergenic
1140710063 16:77669394-77669416 CAGTTTCTTAATCAGGAAACTGG + Intergenic
1141764611 16:86050255-86050277 CAGTCTCTGAAGCAACACACGGG + Intergenic
1143462061 17:7110117-7110139 CAGTGTCTGACTCAGGACAGTGG - Intronic
1144415007 17:15038239-15038261 CAGTCACAGAATCAGAATTCCGG + Intergenic
1145264425 17:21372856-21372878 CAGTGACAGAATCAGGCTACTGG + Intergenic
1147594124 17:41705804-41705826 CAGGTTCAGAAGCAGGACAGGGG + Intergenic
1151707108 17:75774949-75774971 CAGTCTCTGAATCTGAACACAGG + Intergenic
1151998262 17:77626683-77626705 CATTCCCAGCAGCAGGACACAGG + Intergenic
1152475629 17:80516272-80516294 CCGTCAGAGACTCAGGACACAGG - Intergenic
1153013547 18:562965-562987 GAGTCTCTGAATCAGGAAATTGG + Intergenic
1154084062 18:11284919-11284941 CAGTCTCTGAATCTGGCCAGAGG - Intergenic
1159868394 18:73732762-73732784 CAGACCCAGCTTCAGGACACAGG + Intergenic
1160048858 18:75413034-75413056 GTGTCTCATAATCAGAACACAGG - Intronic
1162007719 19:7790539-7790561 CATGCCCAGAATCATGACACAGG - Intergenic
1163790701 19:19304633-19304655 CAGCCTCAGAAACAGGCCAAGGG - Intronic
1167554807 19:50187967-50187989 CAGGCTCAGATTCAGGACAGGGG + Intergenic
1168014271 19:53558700-53558722 CAGCCTCAGAAGCAGGCCTCGGG - Intronic
925101157 2:1247205-1247227 CACACCCAGAATCAGGAGACGGG - Intronic
926571943 2:14538541-14538563 CAGTCTCAGGATGAGGACAAGGG - Intergenic
927501890 2:23588554-23588576 CAGTCTAAGAAGCACCACACTGG - Intronic
928652012 2:33413504-33413526 TGGTCTCAAAATAAGGACACAGG + Intergenic
929583523 2:43099647-43099669 CAGAGGCAGGATCAGGACACAGG - Intergenic
930556169 2:52898500-52898522 AATTCTTAGAATCAGAACACTGG - Intergenic
933050963 2:77601822-77601844 CAAGCTCAGAATCAGGAGAATGG - Intergenic
934165239 2:89288362-89288384 CTGTCTCACAGCCAGGACACAGG + Intergenic
934202035 2:89894100-89894122 CTGTCTCACAGCCAGGACACAGG - Intergenic
938080498 2:128367495-128367517 CAATCTCAGAACCAGGAACCCGG - Intergenic
940650204 2:156434827-156434849 GAGTCTATGAATCAGGTCACTGG + Intergenic
944896014 2:204165639-204165661 CATTCTTAGAATCAGGAGAGTGG + Intergenic
948172250 2:235914247-235914269 CAGTCTCTGTATCAGTAAACTGG - Intronic
948852755 2:240716449-240716471 CAGTCCCAGAGTCTGCACACTGG + Exonic
949067139 2:241998979-241999001 CAGCCTCAGGAACAGGACTCGGG - Intergenic
1170740564 20:19052267-19052289 GTATCTCAGAAACAGGACACTGG + Intergenic
1171220050 20:23388034-23388056 CTGTCTTAGAGCCAGGACACTGG + Intronic
1172539960 20:35704513-35704535 CTGTCATAGAATCAGGAAACAGG + Exonic
1174555518 20:51392664-51392686 CAGTGTCAGAACCAGGAAATGGG - Intronic
1175777568 20:61662880-61662902 CAGGCCCAGGATCGGGACACAGG + Intronic
1175984498 20:62757805-62757827 CAGGCTCAGAGACAGGACACAGG - Intronic
1180701520 22:17783907-17783929 GAGTCTCAGAATCAAGATCCAGG - Intergenic
1180895792 22:19331254-19331276 CAATGTCAGACCCAGGACACAGG + Exonic
1184613396 22:45621154-45621176 CAAACTCAGAAACAGAACACAGG - Intergenic
949372723 3:3352990-3353012 CCATCTCAGAATCAGGAAACCGG + Intergenic
951602945 3:24397040-24397062 CAGTCTAAAAGTCAGGACCCAGG + Intronic
951997062 3:28742858-28742880 CAAACTCAGAATCAAGAAACAGG - Intergenic
952556218 3:34534309-34534331 CAGGCCCAGAATTGGGACACTGG + Intergenic
952655313 3:35778705-35778727 TAGTGCCAGAATTAGGACACAGG - Intronic
953085639 3:39664077-39664099 CTTTCTCAGAAACAGGAGACTGG - Intergenic
953867456 3:46596582-46596604 CAGACTCACAATCACGACTCAGG + Intronic
954568602 3:51621767-51621789 CATTATCAGAATCAGGCCAGAGG + Intronic
956651556 3:71509162-71509184 CAGTATCAGAATCTGCACAAGGG - Intronic
956886602 3:73566471-73566493 CATTTTCAAAATCAGGACAAAGG - Intronic
958094108 3:88919325-88919347 CACTTTCAAAATCAGGAAACTGG - Intergenic
959178079 3:102943018-102943040 CATTGTCAGAATCAGATCACAGG - Intergenic
959596180 3:108131221-108131243 CAGTCTAATAATGAGGAAACTGG - Intergenic
960422969 3:117471066-117471088 TACTCTCAGAGACAGGACACTGG + Intergenic
962628294 3:137249448-137249470 GAGTCTCAGATTCAGGAAAGAGG + Intergenic
962632801 3:137296710-137296732 CAGAATCAGAATCTGAACACAGG + Intergenic
966390590 3:179448948-179448970 CAGTCACTGAAGCAGAACACTGG + Intronic
967223000 3:187264940-187264962 CAGTGTCAGGAACAGGACCCAGG - Intronic
968257653 3:197292002-197292024 CAGTCTCACCAGCAGCACACAGG - Intronic
975215201 4:71745290-71745312 CAGTCTGAGAACCAGTACAAGGG - Intronic
979970642 4:127130582-127130604 CATTCTCAGAAGTAGGAAACAGG + Intergenic
982193701 4:152886126-152886148 GAGTCACTGAATCAGGACAAAGG - Intronic
986243994 5:5988676-5988698 AAGGCTCAGAATCAGGGCCCTGG - Intergenic
987091390 5:14510890-14510912 CAGTCTCTAAGTCAGGACATGGG + Intronic
987868254 5:23574547-23574569 CAATGTCAGAATAAAGACACTGG + Intergenic
988844093 5:35112122-35112144 CAGGCTAAGAAGCAGGGCACAGG - Intronic
993229637 5:85217292-85217314 TTCTCTCAGACTCAGGACACTGG - Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
998950261 5:147386619-147386641 CAGTCACAGAAGCAGCTCACTGG - Exonic
999250081 5:150177187-150177209 CAGTCTGAGAGTCTAGACACTGG - Intronic
999447877 5:151655299-151655321 CAGTATCAAAACCAGGTCACTGG - Intergenic
999780003 5:154841628-154841650 CAAACTCAGAATCAAGCCACAGG - Intronic
1001088143 5:168716619-168716641 CAGTCCTGGAATCAGGTCACAGG - Intronic
1001091239 5:168742480-168742502 CAGTCCTGGAATCAGGTCACAGG + Intronic
1001163259 5:169340167-169340189 CATTAACAGAGTCAGGACACAGG + Intergenic
1001204680 5:169751397-169751419 CAGGCTCAGAATCAAGACTCCGG - Intronic
1005186966 6:23173433-23173455 CACTCACAGAAACAGGATACAGG - Intergenic
1005728403 6:28671841-28671863 CAATCTCAGGATCAGGAAATAGG - Intergenic
1006080400 6:31562094-31562116 CAGTCAGAGAAGCAGGGCACGGG + Intergenic
1006153412 6:32001397-32001419 CAGTCTCACCCTCAGCACACTGG - Exonic
1006159720 6:32034134-32034156 CAGTCTCACCCTCAGCACACTGG - Exonic
1007228629 6:40332249-40332271 CAGTCTGAGATCCAGGACAATGG - Intergenic
1007487091 6:42188436-42188458 CACACTCAGAATGAGAACACAGG + Intronic
1009931763 6:70184520-70184542 CAGTGTCAGAATCCGAACTCAGG + Intronic
1010395311 6:75385197-75385219 TGGTCTGAGAATCAGGAGACTGG - Intronic
1012769261 6:103408021-103408043 CAGTCTCAGGAAAAGGAGACAGG - Intergenic
1013991329 6:116257626-116257648 CAGTCTAAGAATCAGGATGTAGG - Intronic
1014791497 6:125677769-125677791 CAGACTAGGAATCAGGACATGGG + Intergenic
1017067473 6:150542767-150542789 CAGCCTCAGACGCAGGACTCAGG - Intergenic
1017681472 6:156868532-156868554 CAGTCCCGGAACCAGGAAACAGG - Intronic
1018618027 6:165706341-165706363 ATATCTCAGTATCAGGACACAGG + Intronic
1018745505 6:166758533-166758555 CAGAGTCAGACCCAGGACACTGG + Intronic
1020360752 7:7324184-7324206 CTGTCTCAGACTCAGGCCAGAGG + Intergenic
1023487213 7:40699926-40699948 CAGCATCAGAATCAGAACCCAGG + Intronic
1024207134 7:47173395-47173417 CAGTCTCAGAAGCTGGACACAGG - Intergenic
1027471045 7:78574334-78574356 CATTTTCAGAATCAGGAAAGGGG - Intronic
1028151553 7:87379236-87379258 CAGTTTCAGAATCAGTAGAGAGG - Intronic
1030934498 7:115568449-115568471 CTGTCTCTGAATCAGGAGAAGGG - Intergenic
1032704485 7:134410267-134410289 CAGTATAAGAGTTAGGACACAGG + Intergenic
1033343099 7:140507120-140507142 CATTGTCAGATTCAGGAGACAGG - Intergenic
1033480978 7:141740134-141740156 CATTTCCAGAATCATGACACAGG + Intronic
1034872082 7:154694087-154694109 CAGTCTATGAGCCAGGACACAGG - Intronic
1035608504 8:945328-945350 AATTCTCAGAATCAGGTCATTGG + Intergenic
1036152488 8:6311671-6311693 CTGTCTATGAATCAGGACACAGG - Intergenic
1039128516 8:34232350-34232372 CAGTATCTGCATCAGCACACTGG + Intergenic
1039547440 8:38420270-38420292 CACTCACAGAATGAGGACAGAGG + Intronic
1040420980 8:47240336-47240358 CAGGGTCAGAATGAGGATACAGG + Intergenic
1041135813 8:54757639-54757661 CAGACACAGAAGCAGGAGACAGG + Intergenic
1043106661 8:76122088-76122110 CAGTCTGACATTCAAGACACAGG + Intergenic
1043407212 8:79949760-79949782 AAGTCTCTGAAACAGGACAAAGG + Intronic
1044215551 8:89605462-89605484 CAGACTCAGGATCAGGAATCAGG - Intergenic
1044720440 8:95140409-95140431 CAGACACAGAAGCAGTACACGGG - Intronic
1048462346 8:134631772-134631794 CAGTATCAGAATCAGGACTTTGG - Intronic
1048973639 8:139658824-139658846 CAGTGGCAGACTCAGGACATGGG - Intronic
1049246508 8:141565683-141565705 CAGTCTGAGGATGAGGGCACAGG - Intergenic
1051005893 9:12343839-12343861 GAGGCTCAGAAATAGGACACTGG + Intergenic
1053915408 9:42941903-42941925 CTGTCCCACATTCAGGACACAGG - Intergenic
1057857049 9:98609842-98609864 CAGGCTCAGGGCCAGGACACTGG + Intronic
1058185207 9:101846472-101846494 CAGATTCAGAATCTGGACAAAGG - Intergenic
1059948277 9:119435425-119435447 CATTCCGAGACTCAGGACACAGG - Intergenic
1062077333 9:134597934-134597956 TAGACTAAGAATCAGGAAACTGG + Intergenic
1062149095 9:135008197-135008219 CAGTCCCAGAATAGGGACAGTGG - Intergenic
1189732002 X:44030867-44030889 CTGTCATAGAATCAGGAAACAGG - Intergenic
1189924097 X:45934598-45934620 AAGTCTCAGAAGCATGGCACAGG - Intergenic
1190657035 X:52621724-52621746 CAGTCTCAACATCTGCACACTGG + Intergenic
1192238401 X:69311101-69311123 CAGGTTCATAATCAGGAGACCGG - Intergenic
1194364661 X:92999560-92999582 CTGTCTCTGAATCAGGAAGCAGG + Intergenic
1200352527 X:155513525-155513547 CAGTCTCTGAATCAAGCCACAGG + Intronic
1200672889 Y:6115821-6115843 CTGTCTCTGAATCAGGAAGCAGG + Intergenic