ID: 915885112

View in Genome Browser
Species Human (GRCh38)
Location 1:159713715-159713737
Sequence CAGGAGCAGGATTCCTTCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 952
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 929}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915885112 Original CRISPR CAGGAGCAGGATTCCTTCGG TGG (reversed) Exonic
901224421 1:7604721-7604743 GAGGAGCTGGTTTCCTTTGGAGG + Intronic
901959974 1:12818660-12818682 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
903130614 1:21277242-21277264 CAGAAGCAGGATTCCTCCCAAGG + Intronic
904430070 1:30458625-30458647 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
905493008 1:38360098-38360120 CAGGATCATGCTTCCTTCTGAGG + Intergenic
905962960 1:42060328-42060350 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
906571729 1:46847247-46847269 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
906753746 1:48289444-48289466 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
906755721 1:48312647-48312669 GAGGAGCTGCATTCCTTTGGAGG - Intronic
908178291 1:61578425-61578447 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
908637987 1:66189875-66189897 GAGGAGCTGCATTCCTTTGGAGG + Intronic
908726361 1:67181674-67181696 GAGGAGCTGCATTCCTTTGGAGG + Intronic
909307187 1:74096589-74096611 GAGGAGCTGCATTCCTTTGGAGG + Intronic
909446658 1:75755709-75755731 GAGGAGCTGCATTCCTTTGGAGG - Intronic
910067284 1:83168518-83168540 GAGGAGCTGCATTCCTTGGGAGG - Intergenic
910339253 1:86167385-86167407 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
910379718 1:86613503-86613525 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
910398519 1:86814853-86814875 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
910612074 1:89155298-89155320 GAGGAGCTGCATTCCTTTGGAGG - Intronic
910627756 1:89326220-89326242 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
910699845 1:90062329-90062351 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
911074226 1:93856822-93856844 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
911106398 1:94135201-94135223 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
911676811 1:100668019-100668041 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
911891569 1:103378291-103378313 GAGGAGCTGCATTCCTTTGGTGG - Intergenic
913033222 1:114933495-114933517 GAGGAGCTGCATTCCTTTGGAGG - Intronic
913285108 1:117218679-117218701 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
913580660 1:120224036-120224058 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
913627517 1:120674361-120674383 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
913710534 1:121478209-121478231 GAGGAGCAGCGTTCCTTTGGAGG - Intergenic
914208610 1:145558357-145558379 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
914748894 1:150519217-150519239 AGGGAGCAGGATTCCTTCATGGG - Intergenic
914996994 1:152552831-152552853 GAGGAGCTGCATTCCTTTGGAGG + Intronic
915644146 1:157255025-157255047 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
915846989 1:159276911-159276933 CAAGAGCAGGATTCCTTTGGGGG + Intergenic
915873628 1:159588496-159588518 CAGGAACAGGATTCCTATGGGGG + Exonic
915885112 1:159713715-159713737 CAGGAGCAGGATTCCTTCGGTGG - Exonic
916078767 1:161218833-161218855 CAGGAGCTGGAGTCCATCAGAGG - Intronic
916321098 1:163505054-163505076 CAAGAGCAGGAGCCCATCGGAGG + Intergenic
916543750 1:165783049-165783071 GAGGAGCTGCATTCCTTTGGAGG + Intronic
916603326 1:166315925-166315947 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
917010471 1:170464959-170464981 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
917207799 1:172596328-172596350 GAGGAGCTGCATTCCTTTGGAGG + Intronic
918351388 1:183659157-183659179 GAGGAGCTGTATTCCTTTGGAGG - Intronic
918397989 1:184135609-184135631 CAGGAGCTGTGTTCCTTTGGAGG + Intergenic
918408436 1:184234295-184234317 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
919065395 1:192687768-192687790 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
919654786 1:200186451-200186473 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
921043291 1:211454464-211454486 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
921184675 1:212659106-212659128 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
921469706 1:215533299-215533321 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
921842234 1:219840423-219840445 GAGGAGCTGCATTCCTTTGGAGG - Intronic
921846424 1:219887793-219887815 GAGGAGCTGCATTCCTTTGGAGG - Intronic
922785811 1:228281765-228281787 GAGGAGCTGGATTCCTTAGAGGG - Intronic
924130270 1:240900335-240900357 GAGGAGCTGCATTCCTTTGGAGG + Intronic
924609736 1:245563812-245563834 CAGGAGCCCGCTTCCTTCAGAGG - Intronic
924712928 1:246545554-246545576 AAGGAGGAGGATTCATTGGGAGG + Intronic
924941034 1:248812583-248812605 CAGGAGCAGGATTGCTGGGGAGG - Intronic
1063616267 10:7603044-7603066 CAGGTGTAGGATTTCTTCAGTGG - Intronic
1064901036 10:20296450-20296472 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1064924670 10:20556506-20556528 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1065055028 10:21835427-21835449 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1065222481 10:23510968-23510990 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1065472970 10:26102443-26102465 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1066655328 10:37693916-37693938 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
1066709449 10:38217355-38217377 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1066785059 10:38994653-38994675 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1067903211 10:50263480-50263502 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1068239743 10:54289489-54289511 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1068477865 10:57551324-57551346 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1068641494 10:59413379-59413401 GAGGAGCTGCATTCCTTCGGAGG + Intergenic
1069256236 10:66335271-66335293 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1069355812 10:67584109-67584131 AAGGAGCTGCATTCCTTTGGAGG + Intronic
1070411649 10:76147726-76147748 GAGGAGCTGCGTTCCTTCGGAGG + Intronic
1070455421 10:76609597-76609619 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1070893128 10:79957251-79957273 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1071448370 10:85770425-85770447 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1071740705 10:88355255-88355277 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1071763296 10:88633641-88633663 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1071900687 10:90118107-90118129 GAGGAGCTGTATTCCTTTGGAGG + Intergenic
1072311888 10:94164677-94164699 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1072361304 10:94662607-94662629 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
1072364655 10:94696580-94696602 GAGGAGCTGCATTCCTTTGGGGG - Intronic
1072397830 10:95063680-95063702 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1073587460 10:104725017-104725039 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1073647761 10:105323645-105323667 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1073661353 10:105480050-105480072 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1073925062 10:108505482-108505504 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1073966217 10:108993319-108993341 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1074000605 10:109368322-109368344 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1074027730 10:109653446-109653468 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1074030812 10:109686607-109686629 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1074179330 10:111044225-111044247 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1075973848 10:126677410-126677432 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1076665961 10:132092809-132092831 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1076782418 10:132731554-132731576 CAGCAGCAGGTTTTCTTCGCTGG + Intronic
1077591755 11:3497991-3498013 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1077783360 11:5356076-5356098 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1077835072 11:5919417-5919439 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1077901825 11:6496331-6496353 AAGGAGCAGCATTTCTTTGGTGG + Intronic
1078021832 11:7663189-7663211 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1078419793 11:11200893-11200915 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1078666955 11:13333695-13333717 CAGGAGCAGGATGCCTGGTGCGG - Intronic
1078674678 11:13399588-13399610 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1078695541 11:13628128-13628150 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1078780100 11:14430015-14430037 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
1079079926 11:17407014-17407036 CAGGAGCAGGATGCCGGCGGAGG + Exonic
1079174621 11:18127812-18127834 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1079177801 11:18158875-18158897 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1079232404 11:18659844-18659866 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1079463611 11:20707411-20707433 AAGGAGCTGCATTCCTTTGGAGG + Intronic
1079516283 11:21273003-21273025 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1079865003 11:25723778-25723800 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1080031568 11:27666367-27666389 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1080059325 11:27940160-27940182 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1080253932 11:30268179-30268201 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1080366035 11:31574881-31574903 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1080508805 11:32946278-32946300 GAGGAGCAGCGTTCCTTTGGAGG + Intronic
1080871624 11:36241673-36241695 CAGGAACAAGAATCCTTTGGAGG - Intergenic
1080917497 11:36674483-36674505 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1081087569 11:38821319-38821341 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1081172690 11:39888337-39888359 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1081257201 11:40911646-40911668 GAGGAGCCGCATTCCTTTGGAGG - Intronic
1081587324 11:44396261-44396283 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1082107406 11:48235710-48235732 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1082117933 11:48347081-48347103 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1082144335 11:48648888-48648910 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1082147170 11:48684101-48684123 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1082150698 11:48735072-48735094 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1082273608 11:50198805-50198827 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1082317710 11:50750155-50750177 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1082568834 11:54713604-54713626 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1083006185 11:59349207-59349229 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1083494680 11:63041329-63041351 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1083509063 11:63190587-63190609 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1084247594 11:67870710-67870732 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1084825230 11:71724785-71724807 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1085222714 11:74888518-74888540 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1085248084 11:75120366-75120388 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1085368744 11:75978917-75978939 AAGGAGCTGCATTCCTTTGGAGG + Intronic
1085495505 11:76964910-76964932 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1085621845 11:78043703-78043725 CAGGGGCAGGATTCTTCTGGTGG + Intronic
1085800813 11:79587180-79587202 GAGGAGCTGCAATCCTTCGGAGG - Intergenic
1086078546 11:82879578-82879600 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1086529098 11:87763430-87763452 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1086565637 11:88223236-88223258 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1086757470 11:90582504-90582526 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1086786301 11:90973233-90973255 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1086811933 11:91321343-91321365 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
1087080029 11:94161762-94161784 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1087580043 11:100040010-100040032 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1087794379 11:102439643-102439665 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1087916688 11:103819848-103819870 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1088309204 11:108441917-108441939 AAGGAGCTGCATTCCTTTGGAGG - Intronic
1088370421 11:109083108-109083130 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1088974841 11:114806295-114806317 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1089101751 11:115968025-115968047 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1089106058 11:116006001-116006023 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1089298686 11:117484826-117484848 CAGGAACAGGATTCCTCCCCAGG - Intronic
1089816103 11:121177216-121177238 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1090187187 11:124746311-124746333 CAGTACCAGGATTCTTTGGGCGG - Intronic
1090747000 11:129713627-129713649 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1091045529 11:132321126-132321148 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1091052404 11:132384505-132384527 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1091326506 11:134693156-134693178 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1091588063 12:1827317-1827339 CAGGAGCAGGCTTCCTTCGCGGG - Intronic
1092417874 12:8306104-8306126 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1093008662 12:14080523-14080545 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1093309705 12:17564136-17564158 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1093320150 12:17704423-17704445 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1093501370 12:19815590-19815612 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1093609485 12:21136872-21136894 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1093717607 12:22401181-22401203 GAGGAGCTGCATTCCTTTGGTGG - Intronic
1094151149 12:27285134-27285156 CAGAAGCAGCAGTCCTTTGGGGG - Intronic
1094358902 12:29608836-29608858 CAGGAGCTGGATTTCCTCTGAGG - Intronic
1094387535 12:29910986-29911008 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1094760068 12:33521830-33521852 AAGGAGCTGCAATCCTTCGGAGG - Intergenic
1094779486 12:33773952-33773974 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1094803557 12:34066066-34066088 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1094805297 12:34084324-34084346 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1094873444 12:34613546-34613568 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1094875753 12:34640620-34640642 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1095073927 12:37893482-37893504 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1095103868 12:38208305-38208327 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1095105587 12:38229886-38229908 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1095167317 12:38988765-38988787 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1095231691 12:39747026-39747048 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1095429016 12:42112245-42112267 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1095816226 12:46425968-46425990 GAGGAGCTGGGTTCCTTTGGAGG + Intergenic
1095834145 12:46618582-46618604 GAGGAGCTGGGTTCCTTTGGAGG - Intergenic
1096036482 12:48475345-48475367 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1096359752 12:50973589-50973611 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1096850586 12:54433162-54433184 GAGAGGCAGGATTCCTTTGGAGG + Intergenic
1097304374 12:58052899-58052921 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1097344500 12:58476446-58476468 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1097408980 12:59227362-59227384 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1097561220 12:61208633-61208655 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1097758664 12:63435240-63435262 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1097917377 12:65035496-65035518 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1098015427 12:66099771-66099793 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1098120431 12:67231138-67231160 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
1098642523 12:72856472-72856494 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1098722930 12:73925231-73925253 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1098844795 12:75522476-75522498 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1098923114 12:76320588-76320610 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1099008566 12:77264032-77264054 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1099025571 12:77460354-77460376 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
1099261387 12:80386923-80386945 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
1099720644 12:86357420-86357442 GAGGAGCAGCATTCCATTGGAGG - Intronic
1099884332 12:88508684-88508706 CAGGAGGAGGAATCCTAAGGAGG - Intronic
1100653058 12:96611487-96611509 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1101175143 12:102142534-102142556 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1101313993 12:103612727-103612749 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1102562709 12:113773817-113773839 CAGGGGCTGGACTCCTTTGGTGG + Intergenic
1104474573 12:129060946-129060968 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1104516898 12:129435601-129435623 CAGAAGCAGGATTCCTTTGCTGG - Intronic
1105311763 13:19218607-19218629 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1105851982 13:24342950-24342972 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1105875898 13:24553451-24553473 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1106019071 13:25898076-25898098 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1106461989 13:29979116-29979138 CATGAGCAGGATTCCACCAGTGG + Intergenic
1106617369 13:31341670-31341692 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1106646205 13:31637467-31637489 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
1107507251 13:41047319-41047341 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1107558465 13:41539786-41539808 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1108265008 13:48697609-48697631 AAGGAGCTGCATTCCTTTGGAGG - Intronic
1109113363 13:58351598-58351620 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1109276978 13:60314192-60314214 GAGGAGGAGGTTGCCTTCGGAGG + Intergenic
1109949501 13:69482904-69482926 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1109972090 13:69783275-69783297 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1110001601 13:70209805-70209827 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1110698323 13:78518248-78518270 GAGGAGCCGCATTCCTTTGGAGG + Intergenic
1110729135 13:78859948-78859970 GAGGAGCTGCATTCCTTTGGGGG + Intergenic
1110767889 13:79300997-79301019 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
1110891505 13:80704231-80704253 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1111273435 13:85916826-85916848 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1111746888 13:92281847-92281869 AAGGAGCTGCATTCCTTTGGAGG - Intronic
1111967129 13:94871864-94871886 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1112178612 13:97054171-97054193 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1112745571 13:102523113-102523135 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1112835305 13:103507543-103507565 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1114395013 14:22350005-22350027 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
1114747745 14:25168164-25168186 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
1115078059 14:29414832-29414854 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
1115107306 14:29776245-29776267 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1115717589 14:36123469-36123491 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1115792644 14:36897577-36897599 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1115799856 14:36980700-36980722 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1116026939 14:39526599-39526621 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1116038454 14:39656967-39656989 AAGGAGCTGGGTTCCTTTGGAGG - Intergenic
1116042484 14:39702626-39702648 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1116684447 14:48019519-48019541 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
1116727135 14:48575277-48575299 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
1116736513 14:48698226-48698248 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1116773004 14:49149029-49149051 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1117489279 14:56229691-56229713 GAGGAGCTGCATTCCTTTGGGGG - Intronic
1117635733 14:57741180-57741202 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1117722697 14:58642887-58642909 CAATAGCATGATTCCTTCTGGGG - Intronic
1117856675 14:60041791-60041813 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1117936499 14:60913368-60913390 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1117953200 14:61103092-61103114 CAGGAGCAGACTACTTTCGGTGG - Intergenic
1118094615 14:62522176-62522198 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1119006998 14:70941172-70941194 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1119156252 14:72414603-72414625 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1120084204 14:80250726-80250748 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1121213906 14:92232481-92232503 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
1122073614 14:99221609-99221631 CAGGAGCAGGATGCCCACGTGGG + Intronic
1123127695 14:105961161-105961183 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1123822466 15:24044276-24044298 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1123980405 15:25596960-25596982 CAGCAGCTGGAGTCCTGCGGAGG - Intergenic
1124400776 15:29345662-29345684 CAGGAGAAGGAATCCCTGGGGGG - Intronic
1125058474 15:35390883-35390905 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1126049499 15:44673416-44673438 CAAGAGCAGCATTCTTTTGGTGG - Intronic
1126996367 15:54449814-54449836 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1129010559 15:72412626-72412648 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1129631087 15:77261222-77261244 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1130800156 15:87254785-87254807 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1130802525 15:87280358-87280380 CAGGAGCTGTGTTCCTTTGGAGG + Intergenic
1130811014 15:87378313-87378335 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1131555471 15:93394997-93395019 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1131595459 15:93793315-93793337 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1132715505 16:1288222-1288244 CAGGAGCAGGACCACTTGGGTGG - Intergenic
1133938844 16:10291747-10291769 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1134255244 16:12604865-12604887 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1134879676 16:17734238-17734260 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1136930690 16:34415736-34415758 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1136973883 16:34996072-34996094 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1137224617 16:46490942-46490964 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1137326127 16:47438785-47438807 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1137347939 16:47682804-47682826 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1137371568 16:47910954-47910976 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1137437156 16:48465261-48465283 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1137907167 16:52334493-52334515 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1138198753 16:55073683-55073705 CAGGAGCAGGATTCAGTGGGGGG + Intergenic
1138357256 16:56392314-56392336 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1138722432 16:59097502-59097524 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1138734149 16:59230735-59230757 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1138874873 16:60937024-60937046 GAGGAGCTGCATTCCTTAGGAGG - Intergenic
1139268938 16:65664109-65664131 CAGGAGAAAGTTTCCTGCGGTGG - Intergenic
1140054042 16:71510224-71510246 CAGGAGCTGTGTTCCTTTGGAGG + Intronic
1142276340 16:89120854-89120876 TAGGAGCAGGCTTCCCTCTGTGG - Exonic
1143422643 17:6807509-6807531 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1145826723 17:27882659-27882681 CAGGAGCAGAACTGGTTCGGAGG - Exonic
1146298427 17:31669967-31669989 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1146541780 17:33702363-33702385 CAGGAGGAGGCTTCCTGTGGAGG + Intronic
1146580322 17:34031462-34031484 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1146949964 17:36899158-36899180 CAGGAGTGGGATCCCTTCAGTGG - Intergenic
1147902394 17:43797534-43797556 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1148054482 17:44786047-44786069 CATGCGCAGGAGTCCTTAGGAGG + Intergenic
1149591726 17:57834831-57834853 CAAAATCAGGAGTCCTTCGGGGG + Exonic
1152456968 17:80422238-80422260 CAAGAGCAGGATTACCTCGGTGG - Exonic
1153419943 18:4893669-4893691 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1153593615 18:6700888-6700910 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1154401476 18:14042635-14042657 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1155350660 18:24902219-24902241 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1155427030 18:25717235-25717257 GAGGAGCTGTATTCCTTTGGAGG - Intergenic
1156206928 18:34895866-34895888 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1156296050 18:35791696-35791718 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1156308220 18:35898565-35898587 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1156433537 18:37101117-37101139 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1156630644 18:38964326-38964348 CAGCAGCAGAATTCCTTCACAGG + Intergenic
1156980914 18:43287015-43287037 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1157061876 18:44300953-44300975 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1157123320 18:44932994-44933016 AAGGAGCTGCATTCCTTTGGAGG + Intronic
1157920028 18:51705653-51705675 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1158114372 18:53978759-53978781 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
1158273915 18:55746050-55746072 GAGGAGCAGTACTCCTTAGGTGG + Intergenic
1159099451 18:63941450-63941472 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1164248515 19:23456782-23456804 CTGGAGCTGCATTCCTTTGGAGG + Intergenic
1164265703 19:23614495-23614517 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1164377370 19:27700480-27700502 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1164542844 19:29133675-29133697 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1166000642 19:39875603-39875625 GAGCAGCAGGAGTCCTTCGGCGG - Exonic
1166003441 19:39891858-39891880 GAGCAGCAAGAGTCCTTCGGCGG - Exonic
1166022263 19:40042943-40042965 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1166171952 19:41034149-41034171 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1166574147 19:43820795-43820817 TAGGCGCAGGAACCCTTCGGGGG + Intronic
1166613865 19:44225805-44225827 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1168437873 19:56336625-56336647 GAGGAGCTGCATTCCTTTGGAGG + Intronic
924959883 2:24884-24906 GAGGAGCAGCATTGCTTCGCCGG - Intergenic
926305904 2:11637095-11637117 CAGGGACAGGATGCCTTCAGTGG + Intronic
927028043 2:19090351-19090373 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
927235915 2:20874885-20874907 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
927447103 2:23172623-23172645 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
928602906 2:32919054-32919076 CATAAACAGGATTCCTTCGAGGG - Intergenic
928759045 2:34560353-34560375 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
928818164 2:35324796-35324818 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
928852632 2:35767535-35767557 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
929068926 2:38009751-38009773 GAGGAGCTGCATTCCTTTGGAGG + Intronic
929381534 2:41359560-41359582 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
929638226 2:43547906-43547928 GAGGAGCTGCATTCCTTTGGAGG + Intronic
930018018 2:46984229-46984251 CAGTAACAGGATTCCTGCTGTGG - Intronic
930150809 2:48057934-48057956 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
930830783 2:55741405-55741427 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
930835869 2:55793157-55793179 GAGGAGCTGCGTTCCTTCGGAGG + Intergenic
930838032 2:55815103-55815125 GAGGAGCTGCGTTCCTTCGGAGG - Intergenic
930862989 2:56093633-56093655 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
930868069 2:56142178-56142200 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
930893804 2:56422128-56422150 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
930987679 2:57609791-57609813 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
931469122 2:62520571-62520593 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
931475711 2:62585891-62585913 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
931477732 2:62606322-62606344 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
932019177 2:68064841-68064863 GAGGAGCTGCATTCCTTTGGAGG - Intronic
932478018 2:72020987-72021009 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
933018618 2:77162919-77162941 GAGGAGCTGCATTCCTTTGGAGG - Intronic
933023187 2:77220306-77220328 GAGGAGCTGCATTCCTTTGGAGG - Intronic
933202537 2:79466977-79466999 GAGGAGCTGCATTCCTTTGGAGG - Intronic
933257492 2:80098047-80098069 GAGGAGCTGCATTCCTTTGGAGG + Intronic
933269186 2:80215308-80215330 GAGGAGCTGCATTCCTTTGGAGG + Intronic
933366616 2:81362005-81362027 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
933404493 2:81841024-81841046 GAGGAGCTGGGTTCCTTTGGAGG - Intergenic
933568314 2:83977485-83977507 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
933593986 2:84263455-84263477 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
933801656 2:85964882-85964904 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
935118167 2:100156702-100156724 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
935843920 2:107144323-107144345 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
935891905 2:107688116-107688138 GAGGAGCAGGATTCATTCCCTGG + Intergenic
935938493 2:108213595-108213617 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
936553902 2:113476531-113476553 GAGGAGCTGCGTTCCTTCGGAGG + Intronic
936806327 2:116336854-116336876 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
936859716 2:117002213-117002235 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
938156751 2:128948337-128948359 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
938217573 2:129532976-129532998 CAGGAGCTGCATTCCTTTAGAGG - Intergenic
938273977 2:129999588-129999610 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
938799816 2:134751559-134751581 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
939650729 2:144758999-144759021 CAGGAGCAAGCTCCCTTCTGTGG + Intergenic
940008024 2:149027276-149027298 CCGGAGCATGAATCCTTTGGGGG + Intergenic
940067134 2:149642918-149642940 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
940095268 2:149966817-149966839 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
940257318 2:151744420-151744442 GAGGAGCTGTATTCCTTTGGAGG - Intergenic
940379395 2:152996812-152996834 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
940465749 2:154024734-154024756 GAGGAGCTGCATTCCTTTGGAGG + Intronic
940602188 2:155876045-155876067 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
940644343 2:156375302-156375324 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
940827957 2:158434568-158434590 GAGGAGCTGCATTCCTTTGGAGG - Intronic
940891525 2:159040809-159040831 AAGGAGCTGCATTCCTTTGGAGG + Intronic
940992909 2:160115612-160115634 GAGGAGCTGCATTCCTTTGGAGG - Intronic
941550741 2:166912649-166912671 GAGGAGCTGCATTCCTTTGGAGG + Intronic
941559566 2:167027547-167027569 GAGGAGCTGCATTCCTTTGGAGG + Intronic
941623865 2:167809325-167809347 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
942000907 2:171646319-171646341 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
942411848 2:175717669-175717691 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
942723715 2:178983415-178983437 AAGGAGCTGGGTTCCTTTGGAGG - Intronic
942854683 2:180531638-180531660 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
942859315 2:180590649-180590671 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
943125395 2:183789709-183789731 CAGGAGCTGCATTCCTTCAGAGG - Intergenic
943136329 2:183916853-183916875 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
943140576 2:183976522-183976544 GAGGAGCTGGGTTCCTTTGGAGG - Intergenic
943303510 2:186231416-186231438 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
943549423 2:189320266-189320288 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
944599821 2:201291626-201291648 GAGGAGCTGCATTCCTTTGGAGG - Intronic
944600812 2:201301023-201301045 GAGGAGCTGCATTCCTTTGGAGG - Intronic
945351469 2:208785363-208785385 GAGGAGCTGCATTCCTTTGGAGG - Intronic
945352791 2:208801735-208801757 GAGGAGCTGCATTCCTTTGGAGG - Intronic
945667258 2:212757733-212757755 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
945873631 2:215254055-215254077 CAGAAGCTGCATTCCTTTGGAGG - Intergenic
945998050 2:216455800-216455822 GAGGAGCTGCATTCCTTTGGAGG - Intronic
946454992 2:219818548-219818570 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
947708132 2:232292913-232292935 CAGGAACAGGCTTCCCTGGGTGG - Intronic
947728794 2:232417000-232417022 CAGGAGGAGGAGGCCTGCGGAGG + Intergenic
948227582 2:236323442-236323464 CAGGAGGAGGATGACTTCGTGGG + Intergenic
948341097 2:237252812-237252834 CAGGAGCTGGGTTCCTTTGGTGG - Intergenic
948419563 2:237848497-237848519 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1169041877 20:2501913-2501935 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1169882674 20:10364574-10364596 TAGGAGTAGGATTCCATAGGTGG - Intergenic
1170719725 20:18866254-18866276 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1171776224 20:29371098-29371120 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1171898629 20:30835375-30835397 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1172513071 20:35514024-35514046 CAGTAGCAGGATTGCCTCTGTGG + Exonic
1174694601 20:52544021-52544043 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
1175334390 20:58185577-58185599 CAGAGGCAGGATTCCATCCGAGG - Intergenic
1176421012 21:6515291-6515313 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1176915660 21:14622222-14622244 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1176930239 21:14801182-14801204 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1178044509 21:28677995-28678017 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1179696503 21:43123610-43123632 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1180414738 22:12698337-12698359 GAGGAGCTGTATTCCTTTGGAGG - Intergenic
1181342052 22:22188927-22188949 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1181554994 22:23664071-23664093 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1182162259 22:28134309-28134331 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1182993386 22:34789790-34789812 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1184508788 22:44919821-44919843 CAGGTGCCGGCTTCCTTCGTTGG - Intronic
1184629117 22:45762424-45762446 CAGCAGCAGGATTCTTTCCACGG + Intronic
949209304 3:1478567-1478589 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
949224950 3:1682745-1682767 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
949425362 3:3909889-3909911 GAGGAGCTGCATTCCTTCGGAGG - Intronic
949717441 3:6950096-6950118 GAGGAGCTGCATTCCTTTGGAGG + Intronic
949912426 3:8923014-8923036 GAGGAGCTGCATTCCTTTGGAGG - Intronic
950469060 3:13173476-13173498 CAGGAGCAGGAGGCCTTGGGAGG - Intergenic
950597106 3:13994744-13994766 GAGGAGCTGCATTCCTTTGGAGG + Intronic
950605070 3:14071183-14071205 GAGGAGCTGCATTCCTTTGGAGG - Intronic
950796050 3:15511546-15511568 CAGGAGCAGCATTGGTTGGGTGG - Intronic
951861886 3:27262873-27262895 GAGGAGCTGCATTCCTTTGGAGG + Intronic
952049143 3:29362089-29362111 GAGGAGCTGCATTCCTTTGGAGG + Intronic
952290651 3:32011541-32011563 GAGGAGCTGCATTCCTTTGGAGG - Intronic
953032835 3:39189315-39189337 TTGGAGAAGGATTCCTTGGGTGG + Exonic
953053834 3:39371653-39371675 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
953145724 3:40272464-40272486 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
953219723 3:40958912-40958934 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
953305554 3:41825262-41825284 GAGGAGCTGCATTCCTTTGGAGG - Intronic
953337391 3:42104793-42104815 GAGGAGCTGCATTCCTTTGGAGG - Intronic
953930792 3:47004794-47004816 CTGGAACAGGATTCCTTTTGAGG - Intronic
954492607 3:50921598-50921620 GAGGAGCTGCATTCCTTTGGTGG + Intronic
954500687 3:51011665-51011687 GAGGAGCTGCATTCCTTTGGAGG + Intronic
954535863 3:51358814-51358836 CAGGACCAGTATTCCTTGGCAGG + Intronic
954931475 3:54286029-54286051 GAGGAGCTGCATTCCTTTGGAGG - Intronic
955211591 3:56946228-56946250 GAGGAGCTGTATTCCTTTGGAGG - Intronic
955282531 3:57607341-57607363 GAGGAGCTGCGTTCCTTCGGAGG - Intergenic
955478045 3:59359844-59359866 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
956866378 3:73373501-73373523 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
957061803 3:75488506-75488528 GAGGAGCTGTATTCCTTTGGAGG + Intergenic
957101723 3:75836799-75836821 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
957344680 3:78945619-78945641 GAGGAGCTGCATTCCTTTGGAGG - Intronic
957604044 3:82375339-82375361 GAGGAGCGGCATTCCTTTGGAGG + Intergenic
958167876 3:89900490-89900512 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
958569533 3:95861473-95861495 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
958826398 3:99035878-99035900 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
958835442 3:99140088-99140110 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
958978131 3:100690409-100690431 GAGGAGCTGCATTCCTTTGGAGG + Intronic
959052725 3:101540244-101540266 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
959723968 3:109522848-109522870 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
959725734 3:109539270-109539292 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
960832258 3:121862720-121862742 GAGGAGCTGCATTCCTTTGGAGG + Intronic
960859932 3:122142135-122142157 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
961291607 3:125850897-125850919 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
961822425 3:129581988-129582010 CAGGAGCAGGAGTCCTAGTGGGG + Intronic
961895578 3:130165481-130165503 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
962027809 3:131567045-131567067 CAGAAGCATGATGCCTTCAGAGG - Intronic
962180270 3:133199328-133199350 GAGGAGCTGCATTCCTTTGGAGG + Intronic
963528124 3:146439816-146439838 GAGGAGCTGCATTCCTTTGGAGG + Intronic
963678850 3:148348354-148348376 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
963825263 3:149946017-149946039 GAGGAGCTGCATTCCTTTGGAGG - Intronic
963978586 3:151510564-151510586 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
964189729 3:153988433-153988455 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
964715366 3:159715343-159715365 GAGGAGCTGCATTCCTTTGGAGG - Intronic
965717827 3:171625952-171625974 GAGGAGCTGCATTCCTTTGGAGG - Intronic
965886301 3:173451103-173451125 GAGGAGCTGCATTCCTTTGGAGG + Intronic
966140079 3:176747359-176747381 CAGGAGCAGGATTGCTGTGGAGG - Intergenic
966150497 3:176862375-176862397 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
966232155 3:177664398-177664420 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
967013476 3:185460677-185460699 CAGGAATAGGATACCTTCGGGGG + Intronic
967045062 3:185728746-185728768 CAGGAGCAGGATTCAAACGCAGG + Intronic
967768799 3:193311677-193311699 CAGGAGCAGTACTCCTTTGGGGG + Intronic
967797081 3:193610077-193610099 GAGGAGCTGCATTCCTTTGGAGG + Intronic
968375942 4:41613-41635 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
969188186 4:5495617-5495639 GAGGAGCTGCATTCCTTTGGAGG + Intronic
969298055 4:6281139-6281161 CAGGAGCAGGAGCCCTGGGGAGG + Intronic
969747194 4:9081636-9081658 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
970358282 4:15279618-15279640 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
970489570 4:16558160-16558182 GAGGAGCTGGGTTCCTTTGGAGG - Intronic
970585668 4:17512042-17512064 CAGGAGCAGGATGGCGGCGGCGG - Exonic
970611608 4:17729865-17729887 GAGGAGCTGCATTCCTTTGGAGG - Intronic
970611692 4:17730687-17730709 GAGGAGCTGCATTCCTTTGGAGG - Intronic
970983082 4:22124095-22124117 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
971438570 4:26654915-26654937 GAGGAGCTGCATTCCTTTGGAGG + Intronic
972317781 4:37943876-37943898 GAGGAGCTGCATTCCTTTGGAGG + Intronic
972965227 4:44501464-44501486 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
973055455 4:45652270-45652292 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
973546655 4:51989448-51989470 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
973648254 4:52971117-52971139 GAGGAGCTGGGTTCCTTTGGAGG - Intronic
973667640 4:53178599-53178621 GAGGAGCTGCATTCCTTTGGAGG - Intronic
973679264 4:53299045-53299067 GAGGAGCTGCATTCCTTTGGAGG - Intronic
973693626 4:53467441-53467463 GAGGAGCTGCATTCCTTTGGAGG - Intronic
974426117 4:61744815-61744837 GAGGAGCTGCATTCCTTTGGAGG - Intronic
974536598 4:63182830-63182852 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
974774491 4:66462391-66462413 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
974843045 4:67320161-67320183 CATAAGCAGGACTCCTTGGGAGG - Intergenic
974959716 4:68682570-68682592 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
975092719 4:70422950-70422972 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
975255982 4:72235911-72235933 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
975283910 4:72594805-72594827 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
975287364 4:72636384-72636406 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
975295686 4:72731463-72731485 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
975305083 4:72840565-72840587 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
975309186 4:72883781-72883803 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
975513519 4:75220051-75220073 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
975522411 4:75314515-75314537 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
975806417 4:78117871-78117893 GAGGAGCTGCATTCCTTTGGTGG + Intronic
975887307 4:78981485-78981507 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
976170788 4:82302587-82302609 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
976487654 4:85627114-85627136 GAGGAGCTGCATTCCTTTGGAGG + Intronic
976811957 4:89108076-89108098 CTGGAGGAGGATTCCTTCCTTGG - Intronic
976918606 4:90408732-90408754 GAGGAGCTGCATTCCTTTGGAGG - Intronic
976998323 4:91463457-91463479 GAGGAGCTGCATTCCTTTGGAGG - Intronic
977110205 4:92943620-92943642 GAGGAGCTGCATTCCTTTGGAGG + Intronic
977157650 4:93594096-93594118 GAGGAGCTGCATTCCTTTGGAGG + Intronic
977478081 4:97538144-97538166 GAGGAGCTGCATTCCTTTGGAGG - Intronic
977617060 4:99098901-99098923 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
978176147 4:105734721-105734743 TAGGAGCTGCATTCCTTTGGAGG + Intronic
978188095 4:105881245-105881267 GAGGAGCTGCATTCCTTTGGAGG - Intronic
978336938 4:107679254-107679276 CAGGAGGAAGACTCCTTCTGTGG + Intronic
978548478 4:109899344-109899366 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
978893153 4:113853235-113853257 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
979236384 4:118404772-118404794 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
979256508 4:118612429-118612451 GAGGAGCTGCATTCCTTCTGGGG - Intergenic
979440264 4:120742379-120742401 GAGGAGCTGCATTCCTTTGGAGG - Intronic
979599674 4:122574226-122574248 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
981100558 4:140825377-140825399 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
981345584 4:143673133-143673155 GAGGAGCTGCATTCCTTTGGAGG + Intronic
981418926 4:144526667-144526689 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
981441901 4:144792677-144792699 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
981607697 4:146557962-146557984 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
981687452 4:147470841-147470863 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
982310757 4:153983117-153983139 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
982405956 4:155020816-155020838 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
982620038 4:157692582-157692604 GAGGAGCTGGGTTCCTTTGGAGG - Intergenic
982801664 4:159714579-159714601 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
982820062 4:159934113-159934135 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
983181122 4:164650144-164650166 GAGGAGCTGTGTTCCTTCGGAGG - Intergenic
983183651 4:164676975-164676997 GAGTAGCAGCATTCCTTTGGAGG - Intergenic
983598689 4:169499443-169499465 GAGGAGCTGCATTCCTTTGGAGG + Intronic
983668401 4:170208171-170208193 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
983681883 4:170362895-170362917 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
983694323 4:170510136-170510158 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
983963927 4:173786993-173787015 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
983978651 4:173967934-173967956 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
984307697 4:178015997-178016019 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
984383918 4:179031036-179031058 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
985072851 4:186185435-186185457 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
985988010 5:3533547-3533569 CAGGAGCAGGAAGACTTGGGTGG - Intergenic
986530544 5:8731941-8731963 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
986655146 5:10003484-10003506 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
987307119 5:16648219-16648241 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
988646469 5:33100942-33100964 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
988668151 5:33353209-33353231 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
988843456 5:35105319-35105341 GAGGAGCTGCATTCCTTTGGAGG - Intronic
988859298 5:35260998-35261020 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
989302297 5:39908376-39908398 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
989345185 5:40422234-40422256 AAGGAGCAGCAGTCCTTTGGAGG + Intergenic
989562117 5:42863901-42863923 GAGGAGCTGCATTCCTTTGGAGG - Intronic
989608116 5:43265667-43265689 AAGGAGCTGCATTCCTTTGGAGG + Intronic
989660563 5:43792724-43792746 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
989662283 5:43813213-43813235 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
989684128 5:44064921-44064943 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
989768680 5:45116864-45116886 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
989784732 5:45313467-45313489 GAGGAGCTGCATTCCTTTGGAGG - Intronic
989843534 5:46111257-46111279 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
989956627 5:50367852-50367874 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
989966344 5:50470323-50470345 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
990482267 5:56222445-56222467 GAGGAGCTGCATTCCTTTGGTGG - Intronic
990678733 5:58216993-58217015 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
990750556 5:59011240-59011262 GAGGAGCTGCATTCCTTTGGAGG - Intronic
991543773 5:67758639-67758661 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
991602690 5:68369302-68369324 CAGGAGAAGGATTCCTTGGAGGG - Intergenic
991634726 5:68692666-68692688 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
992031817 5:72728691-72728713 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
992274564 5:75101973-75101995 GAGGAGCTGCATTCCTTTGGAGG + Intronic
992338597 5:75799229-75799251 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
992354666 5:75968276-75968298 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
992634173 5:78710836-78710858 GAGGAGCTGCATTCCTTTGGAGG - Intronic
992659423 5:78944319-78944341 GAGGAGCTGCATTCCTTTGGAGG + Intronic
992873597 5:81029744-81029766 AAGGAGCTGCATTCCTTTGGAGG - Intronic
992973236 5:82083923-82083945 AAGGAGCTGCATTCCTTTGGAGG - Intronic
993052837 5:82945129-82945151 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
993068733 5:83132931-83132953 GAGGAGCTGCATTCCTTTGGAGG + Intronic
993370423 5:87085506-87085528 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
993471499 5:88313045-88313067 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
993528176 5:88992463-88992485 GAGGAGCTGTATTCCTTTGGAGG + Intergenic
993864034 5:93171586-93171608 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
994143433 5:96366869-96366891 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
994280987 5:97902190-97902212 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
994287932 5:97992399-97992421 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
994492339 5:100463183-100463205 GAGGAGCTGGGTTCCTTTGGAGG + Intergenic
994664172 5:102688467-102688489 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
995309400 5:110693404-110693426 GAGGAGCTGCATTCCTTTGGAGG - Intronic
995329948 5:110935065-110935087 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
995467441 5:112465775-112465797 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
995530901 5:113091107-113091129 CAGCCTCAGGATTCCTTCTGTGG - Intronic
995633706 5:114162043-114162065 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
995692754 5:114845502-114845524 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
996012964 5:118501811-118501833 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
996114250 5:119600412-119600434 GAGGAGCTGCATTCCTTTGGAGG - Intronic
996162319 5:120181070-120181092 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
996514996 5:124359329-124359351 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
996524415 5:124462893-124462915 CAGGAGAAGGCTTCCTTGGCTGG - Intergenic
996832126 5:127752156-127752178 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
997107148 5:131033756-131033778 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
997112293 5:131088237-131088259 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
997117154 5:131137959-131137981 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
997184961 5:131872098-131872120 GAGGAGCTGCATTCCTTTGGAGG - Intronic
997797743 5:136828054-136828076 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
997861575 5:137422826-137422848 GAGGAGCTGCATTCCTTTGGAGG + Intronic
998048444 5:139010504-139010526 GAGGAGCTGCATTCCTTTGGAGG + Intronic
998541860 5:142990504-142990526 GAGGAGCTGCATTCCTTGGGAGG + Intronic
998607136 5:143647046-143647068 CAGAAGCAGGACTCCTTCAGAGG + Intergenic
998626603 5:143853159-143853181 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
999485409 5:151989992-151990014 GAGGAGCTGGGTTCCTTTGGAGG - Intergenic
999570875 5:152918725-152918747 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
999692550 5:154161118-154161140 CAGGAGTAGGATTTCCTCAGTGG - Intronic
999814489 5:155162642-155162664 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1000746921 5:165045490-165045512 TAGGAGCTGCATTCCTTTGGAGG + Intergenic
1000831110 5:166102454-166102476 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1001983451 5:176052837-176052859 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1002011182 5:176282624-176282646 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1002216483 5:177638582-177638604 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
1002234017 5:177791215-177791237 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1002265469 5:178028840-178028862 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1003783080 6:9451375-9451397 CAGAAGCAGCTTTCCTTCAGAGG + Intergenic
1004441650 6:15660780-15660802 CAGGAGCATGAATGCTTCTGAGG + Intronic
1005202589 6:23364014-23364036 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1005788801 6:29274531-29274553 GAGGAGCCGCATTCCTTTGGAGG - Intergenic
1005924558 6:30431367-30431389 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1007155379 6:39737487-39737509 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1007711025 6:43824342-43824364 CAGGACCAGGATTCCTTGCTGGG + Intergenic
1007977968 6:46120532-46120554 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1008388382 6:50920875-50920897 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1008398430 6:51036438-51036460 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1008671663 6:53775114-53775136 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1008829141 6:55736622-55736644 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1008961725 6:57273668-57273690 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1009045350 6:58231641-58231663 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1009221166 6:60985971-60985993 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1009519011 6:64658393-64658415 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1009695413 6:67096490-67096512 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1010093120 6:72007424-72007446 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1010281623 6:74029714-74029736 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1010503357 6:76628187-76628209 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1010553611 6:77252606-77252628 GAGGAGCTGCATTCCTTCAGAGG - Intergenic
1010652218 6:78468290-78468312 TAGGAGCTGCATTCCTTTGGAGG - Intergenic
1010667561 6:78647828-78647850 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1010683031 6:78818606-78818628 AAGGAACTGCATTCCTTCGGAGG - Intergenic
1010688424 6:78878592-78878614 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1010737613 6:79460611-79460633 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1010990123 6:82470605-82470627 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1010993032 6:82501478-82501500 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1011012367 6:82716301-82716323 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1011081738 6:83496747-83496769 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1011200531 6:84831469-84831491 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1011308685 6:85957947-85957969 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1011338054 6:86283174-86283196 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1011348147 6:86393667-86393689 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1011432472 6:87302128-87302150 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1011838832 6:91470013-91470035 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1012089439 6:94873324-94873346 GAGGAGCTGTGTTCCTTCGGAGG + Intergenic
1012203979 6:96438048-96438070 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
1012520977 6:100120768-100120790 AAGGAACAGGATTCCTGCAGTGG + Intergenic
1012673742 6:102089158-102089180 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1012680265 6:102170628-102170650 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1012739949 6:103003981-103004003 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
1012844814 6:104375693-104375715 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1013906263 6:115223160-115223182 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1014345754 6:120267763-120267785 GAGGAGCTGCATTCCTTTGGTGG + Intergenic
1014423050 6:121268203-121268225 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1015247179 6:131087414-131087436 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1015430229 6:133122699-133122721 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1016688011 6:146903142-146903164 CAGGAGCAAGATTCCTCCTGAGG - Intergenic
1018114074 6:160565621-160565643 GAGGAGCTGCGTTCCTTCGGAGG - Intronic
1018525656 6:164707794-164707816 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1018749425 6:166789962-166789984 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1018760069 6:166885908-166885930 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1018782981 6:167085980-167086002 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1019097884 6:169600414-169600436 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1020449209 7:8303156-8303178 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1020454202 7:8352696-8352718 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1021112570 7:16712313-16712335 CAGGATCATGATTTCTTGGGTGG - Intergenic
1021342179 7:19479088-19479110 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
1021375812 7:19905580-19905602 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1021389014 7:20068883-20068905 GAGGAGCTGGGTTCCTTTGGAGG - Intergenic
1022453691 7:30538565-30538587 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1022590555 7:31657338-31657360 CAGAAGCAGGACTCCTCTGGTGG - Intronic
1023671825 7:42585613-42585635 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1024613390 7:51085922-51085944 CAGGAGCTGGATTTCTGCTGTGG - Intronic
1024892452 7:54219211-54219233 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1025122044 7:56313586-56313608 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1025582825 7:62741817-62741839 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
1025601067 7:62998248-62998270 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1025737260 7:64161609-64161631 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1025876184 7:65481363-65481385 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1026643018 7:72143075-72143097 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1028159167 7:87465999-87466021 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1028395420 7:90364176-90364198 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1028436265 7:90807566-90807588 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1028983660 7:96993400-96993422 TAGGAGCAAGATTCCATTGGCGG - Intergenic
1029059935 7:97786691-97786713 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1029313263 7:99687123-99687145 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1029808132 7:103017425-103017447 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1029829939 7:103245682-103245704 GAGGAGCAGCGTTCCTTTGGAGG - Intergenic
1029979561 7:104865175-104865197 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1030142713 7:106321220-106321242 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1030817619 7:114056018-114056040 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1031314509 7:120239872-120239894 CAGGAGCTGCGTTCCTTTGGAGG + Intergenic
1032764451 7:134977080-134977102 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1033125047 7:138699989-138700011 CAACAACAGGATTCCTTTGGTGG + Intronic
1033776304 7:144615246-144615268 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1034028725 7:147737063-147737085 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1035493410 7:159299462-159299484 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1036563867 8:9921382-9921404 CAGGAGAAGGATGCCTTCTGGGG + Intergenic
1036584445 8:10110263-10110285 CTGGAGCAGGTTTTCTTTGGTGG + Intronic
1036745614 8:11407099-11407121 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1037641093 8:20743776-20743798 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1038221629 8:25614400-25614422 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1038655827 8:29450289-29450311 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1038782484 8:30580053-30580075 CAAGAGCAGGACTGCTTGGGAGG + Intronic
1038929067 8:32172446-32172468 AAGGAGCTGCATTCCTTTGGAGG - Intronic
1039146245 8:34450790-34450812 GAGGAGCTGCATTCCTTTGGGGG + Intergenic
1039154666 8:34541318-34541340 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1039281399 8:35989343-35989365 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1040078576 8:43265614-43265636 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1040097315 8:43458975-43458997 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1040364738 8:46704304-46704326 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1040651045 8:49448995-49449017 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1040749817 8:50692290-50692312 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1040962334 8:53048187-53048209 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
1041027277 8:53700198-53700220 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1041161662 8:55050939-55050961 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1041203878 8:55477506-55477528 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1041275268 8:56151179-56151201 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1041286238 8:56265349-56265371 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1041295764 8:56356243-56356265 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1041314982 8:56551396-56551418 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1041338173 8:56811618-56811640 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1041750300 8:61253961-61253983 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1041771687 8:61479624-61479646 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1041772086 8:61482297-61482319 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1041999353 8:64103331-64103353 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1042155696 8:65841986-65842008 GAGGAGCAGGACTCCGGCGGCGG - Intronic
1042362155 8:67895029-67895051 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1042534472 8:69844384-69844406 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1042687002 8:71452869-71452891 AAGGAGCTGCATTCCTTTGGAGG - Intronic
1042816872 8:72887618-72887640 CAGGAGAAGGCTTCCTTCCAAGG + Intronic
1042887671 8:73569908-73569930 GAGGAGCTGTATTCCTTTGGAGG - Intronic
1043177712 8:77042942-77042964 GAGGAGCTGCATTCCTTTGGTGG - Intergenic
1043236870 8:77879529-77879551 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1043241621 8:77941468-77941490 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1043411771 8:80004586-80004608 AAGGAGCTGCATTCCTTTGGAGG - Intronic
1044042399 8:87386213-87386235 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1044061942 8:87649103-87649125 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1044178876 8:89163956-89163978 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1044272674 8:90265198-90265220 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1044282873 8:90376520-90376542 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1045083272 8:98651441-98651463 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1045386127 8:101672154-101672176 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1045419632 8:102000976-102000998 GAGGAGCTGTATTCCTTTGGAGG - Intronic
1045788808 8:105956750-105956772 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
1045802391 8:106117016-106117038 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
1045939034 8:107716968-107716990 GAGGAGCTGCATTCCTTTGGGGG + Intergenic
1046704546 8:117435402-117435424 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1046811132 8:118534993-118535015 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1048138763 8:131771865-131771887 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1048156597 8:131961161-131961183 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1048858553 8:138704722-138704744 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1049875708 8:145018858-145018880 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1050034751 9:1423786-1423808 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1050178894 9:2899090-2899112 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1050478168 9:6062697-6062719 TAGGAGCTGCATTCCTTTGGAGG + Intergenic
1050509073 9:6375281-6375303 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1050509344 9:6377357-6377379 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1051314884 9:15818295-15818317 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1051452682 9:17215094-17215116 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1051790874 9:20800889-20800911 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1051905919 9:22094854-22094876 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1051987350 9:23106180-23106202 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1052131958 9:24858895-24858917 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1052239177 9:26250733-26250755 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1052499524 9:29271291-29271313 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1052620341 9:30900175-30900197 CAGGACCAGGCTCCCTTTGGAGG + Intergenic
1052992818 9:34531584-34531606 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1053029897 9:34766741-34766763 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1053038700 9:34850643-34850665 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1053041751 9:34879305-34879327 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1055853850 9:80663220-80663242 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1056203574 9:84299633-84299655 CAGCAGCTGGTGTCCTTCGGTGG - Exonic
1056582638 9:87903212-87903234 CAGGAGCTGCGTTCCTTTGGAGG - Intergenic
1057163044 9:92904958-92904980 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1057519058 9:95746559-95746581 GAGGAGCAGGATTTTTTCGGGGG - Intergenic
1058085924 9:100748516-100748538 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
1058595051 9:106606070-106606092 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
1058943682 9:109836479-109836501 AAGGAGCTGCATTCCTTTGGTGG - Intronic
1059616933 9:115961866-115961888 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1060131033 9:121099500-121099522 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1060615739 9:125011133-125011155 GAGGAGCTGCATTCCTTTGGCGG - Intronic
1061573386 9:131491523-131491545 CGGGCGGAGGAATCCTTCGGGGG - Exonic
1203365869 Un_KI270442v1:255104-255126 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1203573286 Un_KI270744v1:152537-152559 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1185655797 X:1684549-1684571 CAGGACCATGCTTCCTCCGGAGG - Intergenic
1186702623 X:12107499-12107521 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
1186956465 X:14687842-14687864 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1186982644 X:14974042-14974064 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
1186993043 X:15089498-15089520 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1187857397 X:23650738-23650760 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1188035970 X:25317971-25317993 GAGGAGCTGCATTCCTTAGGAGG + Intergenic
1188238767 X:27759642-27759664 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1189045518 X:37586838-37586860 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1189313422 X:40035934-40035956 CTGGAGCTGGAATCCTTTGGGGG - Intergenic
1190358103 X:49625095-49625117 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1190923656 X:54882104-54882126 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1191049569 X:56177143-56177165 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1191063291 X:56320742-56320764 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1191066833 X:56357669-56357691 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1191072843 X:56420676-56420698 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1191114773 X:56841232-56841254 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1191138249 X:57090041-57090063 CAGGAGCTGTGTTCCTTTGGAGG + Intergenic
1191144447 X:57151799-57151821 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1191170608 X:57443655-57443677 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1191192882 X:57685353-57685375 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1191194865 X:57709617-57709639 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1191196582 X:57730416-57730438 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1191567344 X:62556538-62556560 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1191683454 X:63865376-63865398 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1191704832 X:64083900-64083922 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1191799124 X:65058123-65058145 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1191828177 X:65388683-65388705 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1191835061 X:65455077-65455099 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1191935460 X:66423042-66423064 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1192045101 X:67664161-67664183 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1192101151 X:68265628-68265650 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1192154927 X:68737336-68737358 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1192385313 X:70661968-70661990 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1192401431 X:70839590-70839612 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1192523046 X:71817737-71817759 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1192802433 X:74479525-74479547 GAGGAGGTGCATTCCTTCGGAGG + Intronic
1192850879 X:74954344-74954366 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1192900381 X:75489691-75489713 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1192912294 X:75617481-75617503 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1192985561 X:76395487-76395509 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1193029635 X:76883291-76883313 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1193033615 X:76925455-76925477 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1193051268 X:77102451-77102473 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1193123330 X:77846474-77846496 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1193182174 X:78471270-78471292 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1193216103 X:78866503-78866525 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1193323842 X:80156344-80156366 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1193620940 X:83751585-83751607 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1193787003 X:85771927-85771949 TAGGAGCTGCATTCCTTTGGAGG + Intergenic
1194370153 X:93061268-93061290 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1194636448 X:96350405-96350427 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
1194658215 X:96598715-96598737 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
1194944582 X:100051862-100051884 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1194962990 X:100256573-100256595 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1195126170 X:101811964-101811986 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1195340483 X:103902158-103902180 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1195417443 X:104635884-104635906 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1195553467 X:106194582-106194604 GAGGAGCTGTGTTCCTTCGGAGG + Intronic
1195603046 X:106770797-106770819 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1195735963 X:108012495-108012517 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1195856101 X:109334861-109334883 AAGGAGCTGCATTCCTTCAGAGG + Intergenic
1196012415 X:110903357-110903379 CAGGAGCTGCAATCCTTTGGAGG + Intergenic
1196474629 X:116068488-116068510 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1196874448 X:120144638-120144660 CAGGAGCAGGAGAACTTGGGAGG + Intergenic
1197239582 X:124109440-124109462 GAGGAGCTGCATTCCTTTGGAGG + Intronic
1197284882 X:124583636-124583658 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1197369911 X:125613991-125614013 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1197432573 X:126384233-126384255 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1197574954 X:128200022-128200044 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1197667802 X:129241938-129241960 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1197737022 X:129858687-129858709 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1198123870 X:133622251-133622273 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1198166355 X:134061694-134061716 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1198474398 X:136982164-136982186 GAGGAGCTGTATTCCTTTGGAGG + Intergenic
1198553419 X:137768357-137768379 GAGGAGCTGTATTCCTTTGGAGG + Intergenic
1198581921 X:138074482-138074504 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
1198615775 X:138456927-138456949 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1198643301 X:138779265-138779287 GAGGAGCTGGGTTCCTTTGGAGG - Intronic
1198689120 X:139260621-139260643 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1198712907 X:139524635-139524657 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1198856129 X:141018803-141018825 GAGGAGCAGCGTTCCTTTGGAGG + Intergenic
1198876003 X:141227308-141227330 GAGGAGCAGCGTTCCTTTGGAGG - Intergenic
1198906562 X:141568564-141568586 GAGGAGCAGCGTTCCTTTGGAGG - Intergenic
1198916863 X:141682238-141682260 GAGGAGCAGCGTTCCTTTGGAGG - Intronic
1199195229 X:145021055-145021077 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1199484145 X:148330502-148330524 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1200297829 X:154940115-154940137 GAGGAGCTGCATTCCTTTGGAGG - Intronic
1200689587 Y:6293800-6293822 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
1200778687 Y:7195017-7195039 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1200833412 Y:7710168-7710190 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1200874512 Y:8139362-8139384 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1200956124 Y:8948089-8948111 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1201045685 Y:9880920-9880942 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
1201347955 Y:13005314-13005336 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1201393690 Y:13524979-13525001 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1201466174 Y:14283251-14283273 AAGGAGCTGCATTCCTTTGGAGG - Intergenic
1201645192 Y:16222893-16222915 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1201657621 Y:16362429-16362451 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1201684394 Y:16684290-16684312 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1201731967 Y:17213836-17213858 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1201800073 Y:17945264-17945286 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1201801480 Y:17960692-17960714 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1201908937 Y:19113958-19113980 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1201920811 Y:19231858-19231880 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
1201923112 Y:19255527-19255549 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1201956825 Y:19633900-19633922 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1201971557 Y:19802669-19802691 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1202014404 Y:20385596-20385618 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1202020699 Y:20462303-20462325 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1202034638 Y:20619880-20619902 AAGGAGCTGCATTCCTTTGGAGG + Intergenic
1202055172 Y:20822244-20822266 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1202166490 Y:21995168-21995190 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1202224868 Y:22591205-22591227 GAGGAGCTGCATTCCTTTGGAGG - Intergenic
1202318246 Y:23604455-23604477 GAGGAGCTGCATTCCTTTGGAGG + Intergenic
1202552521 Y:26065602-26065624 GAGGAGCTGCATTCCTTTGGAGG - Intergenic