ID: 915888179

View in Genome Browser
Species Human (GRCh38)
Location 1:159745788-159745810
Sequence CTCAGGCCAAATAAACTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915888174_915888179 20 Left 915888174 1:159745745-159745767 CCTGTCTCACTTTACTCAGTGTC No data
Right 915888179 1:159745788-159745810 CTCAGGCCAAATAAACTGTCTGG No data
915888173_915888179 21 Left 915888173 1:159745744-159745766 CCCTGTCTCACTTTACTCAGTGT No data
Right 915888179 1:159745788-159745810 CTCAGGCCAAATAAACTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915888179 Original CRISPR CTCAGGCCAAATAAACTGTC TGG Intergenic
No off target data available for this crispr