ID: 915891146

View in Genome Browser
Species Human (GRCh38)
Location 1:159774962-159774984
Sequence CCCCGACCTGTGAGATCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915891146_915891153 27 Left 915891146 1:159774962-159774984 CCTGAGGATCTCACAGGTCGGGG No data
Right 915891153 1:159775012-159775034 CTCCCATGTGACATCAACTGTGG No data
915891146_915891151 4 Left 915891146 1:159774962-159774984 CCTGAGGATCTCACAGGTCGGGG No data
Right 915891151 1:159774989-159775011 TGAGATTCCGCATCTATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915891146 Original CRISPR CCCCGACCTGTGAGATCCTC AGG (reversed) Intergenic
No off target data available for this crispr