ID: 915894256

View in Genome Browser
Species Human (GRCh38)
Location 1:159799137-159799159
Sequence CTCTGGGTCTGGCCTACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 1, 2: 3, 3: 21, 4: 252}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915894256_915894265 17 Left 915894256 1:159799137-159799159 CCCTCTGTAGGCCAGACCCAGAG 0: 1
1: 1
2: 3
3: 21
4: 252
Right 915894265 1:159799177-159799199 CTCCATTTTCACCCTACTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 202
915894256_915894259 -10 Left 915894256 1:159799137-159799159 CCCTCTGTAGGCCAGACCCAGAG 0: 1
1: 1
2: 3
3: 21
4: 252
Right 915894259 1:159799150-159799172 AGACCCAGAGCTTCATGCCCAGG 0: 1
1: 0
2: 1
3: 22
4: 189
915894256_915894262 -6 Left 915894256 1:159799137-159799159 CCCTCTGTAGGCCAGACCCAGAG 0: 1
1: 1
2: 3
3: 21
4: 252
Right 915894262 1:159799154-159799176 CCAGAGCTTCATGCCCAGGCTGG 0: 1
1: 0
2: 5
3: 24
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915894256 Original CRISPR CTCTGGGTCTGGCCTACAGA GGG (reversed) Intergenic
900130242 1:1084295-1084317 CCCTGGGACTGGCCCAGAGATGG + Intronic
900590350 1:3456679-3456701 CTGTGTGTCTGTCCTACAGCGGG + Intronic
900703198 1:4060678-4060700 CTCTGGGCTTGGCCTGCAGAAGG + Intergenic
900880717 1:5379419-5379441 CTCTTGATCTGGCCTTCAGAAGG - Intergenic
901635100 1:10666866-10666888 CACAGGGTCTGGCCCACAGAAGG - Intronic
902225921 1:14996447-14996469 CACAGGGCCTGGCCTACAGTGGG + Intronic
902228648 1:15013230-15013252 ATGAGGGTCTGGCATACAGAAGG - Intronic
903386964 1:22933298-22933320 CTCTGGCTGTGGCCTCCAGCTGG - Intergenic
903814951 1:26058100-26058122 CTCAGTGCCTGGCCTACAGTAGG + Intronic
904006128 1:27364211-27364233 CTGTGGGTGTGGCCTCCAGCAGG + Exonic
904285656 1:29451903-29451925 CTCAGGGCCTGGCATACAGTAGG - Intergenic
904419765 1:30384122-30384144 CTCAGGGCCTGGCATACAGTAGG + Intergenic
905262831 1:36731437-36731459 CTCTGCCTCTGGCCTTCAGTTGG + Intergenic
906077830 1:43065168-43065190 CTCAGGGTCTGGCCCATGGAGGG + Intergenic
907267446 1:53271543-53271565 CTCTGTGTCTGGCCTGGAGTAGG - Intronic
909340227 1:74523634-74523656 CTCAGGGCCTGGCATACAGTAGG - Intronic
910000013 1:82330631-82330653 CTCTGTGTGTGGCTTGCAGATGG + Intergenic
915466658 1:156102328-156102350 CTCTGGGCCTGGGGTACAGAGGG + Intronic
915681219 1:157583599-157583621 CTCTCTTTCTGGCTTACAGAAGG - Intronic
915839926 1:159205442-159205464 CTCTGGGTATGTCCTCCAGGCGG + Exonic
915894256 1:159799137-159799159 CTCTGGGTCTGGCCTACAGAGGG - Intergenic
916418783 1:164616976-164616998 CTCTGGATCTGGACTCCAGGTGG - Intronic
919870785 1:201819775-201819797 CTCTGGGTCCTGCCCACAGAAGG - Intronic
920695940 1:208181339-208181361 CTCAGGGTCTGGCCCCCTGAAGG - Intronic
922547705 1:226471081-226471103 CTCTGGGCCTGGGCAACACAAGG - Intergenic
1063077901 10:2734695-2734717 CTCTGGGTCAGCCACACAGACGG - Intergenic
1065116927 10:22492335-22492357 CTATAGGTCTGTCCTACGGAGGG - Intergenic
1067467538 10:46512118-46512140 CTCAGTGCCTGGCATACAGAAGG + Intergenic
1067619648 10:47872487-47872509 CTCAGTGCCTGGCATACAGAAGG - Intergenic
1068072729 10:52216144-52216166 CTATTGGTTTGGACTACAGATGG + Intronic
1068632724 10:59314296-59314318 TTCAGGGTCTGGCCCACAGCAGG - Intronic
1070321172 10:75355776-75355798 CTATGGGTCTGGAATTCAGATGG + Intergenic
1070890410 10:79938815-79938837 CTCTGGGTCTGGCCTCATGTCGG + Intronic
1074077014 10:110137777-110137799 CACAGGGTCTGGCACACAGATGG - Intergenic
1074913280 10:117931683-117931705 CTCTGAGTGTGGCCCATAGATGG + Intergenic
1075235154 10:120721283-120721305 CTCTGGAACTGGCCTACTGCAGG + Intergenic
1075561784 10:123473562-123473584 CTCTGGCCCTGACTTACAGAAGG - Intergenic
1077043429 11:534447-534469 CTGTGGGTTTGCCCTTCAGATGG - Intronic
1077752134 11:4984051-4984073 TGCTGGGTCAGGCTTACAGATGG + Intronic
1080406289 11:31982445-31982467 CTTTGGGTTTGGCCAATAGAAGG - Intronic
1082275695 11:50219083-50219105 CACTGTGCCTGGCCCACAGAGGG - Intergenic
1084491349 11:69480275-69480297 CTCAGGGTCAGGCCTGCAGAAGG - Intergenic
1085195143 11:74666330-74666352 CACTGCGTCTGGCCTTCAAATGG - Intronic
1085388220 11:76169206-76169228 CTCTGGGGCTGGGCTGGAGAGGG + Intergenic
1087226121 11:95601000-95601022 CTCTGTGCCTGGCCTAAAGTAGG + Intergenic
1089318877 11:117611511-117611533 CACAGTATCTGGCCTACAGAAGG + Intronic
1089752117 11:120659422-120659444 CTCAGGGTCTGGCCTAAATGAGG - Intronic
1093664563 12:21795866-21795888 CGGTGGGTGCGGCCTACAGAGGG - Intergenic
1094847837 12:34369150-34369172 CCCTGGTTCGTGCCTACAGAAGG - Intergenic
1097388177 12:58975953-58975975 CTCTGGGTATAGCATAAAGAGGG - Intergenic
1097910897 12:64968044-64968066 CTCTCTTCCTGGCCTACAGACGG - Intergenic
1098439677 12:70504508-70504530 GTCAGGGTCAGGCCTAAAGAGGG + Intergenic
1098591920 12:72224270-72224292 CTCTGGTTCTGGTCTACCTAGGG - Intronic
1099279743 12:80629032-80629054 CTCTCTTTCTGGCTTACAGATGG + Intronic
1101908735 12:108847185-108847207 CACTGGGCCTGGCCTAGACAAGG + Intronic
1102345662 12:112159502-112159524 CAGTGGGTGTAGCCTACAGAGGG - Intergenic
1102931141 12:116863262-116863284 TTCTGGGTTTGGCCAACAGGAGG + Intronic
1104859445 12:131916864-131916886 ATGTGTGTCTGGCCTGCAGAGGG + Intronic
1106032381 13:26014904-26014926 CTCTGTGTCTGGCATACAGAAGG - Intronic
1110479923 13:75962087-75962109 CTCTGGTTCTTACCAACAGAGGG - Intergenic
1111156741 13:84337836-84337858 CTCTAGGGGTTGCCTACAGATGG + Intergenic
1112819648 13:103316709-103316731 CTCTGGCTTTGGCCTTTAGAAGG + Intergenic
1113186963 13:107698807-107698829 TTCTGGGTCTTGCCTTCAAAGGG + Intronic
1119572760 14:75690654-75690676 CTGTGGTTCTGGGCTACAGAGGG - Intronic
1121122574 14:91385269-91385291 CCCTGGGTCTGGGGTAGAGATGG - Intronic
1121521611 14:94589914-94589936 CTCTGGGGCTGCCATAAAGATGG + Intronic
1122075091 14:99230728-99230750 GTCTGGGTCTGGCCCAGAGCCGG + Intronic
1122079281 14:99255914-99255936 CTCTGGGCCTTGCCTTCTGATGG - Intronic
1123060429 14:105591920-105591942 CCGTACGTCTGGCCTACAGACGG + Intergenic
1202864449 14_GL000225v1_random:105965-105987 GTCTGGGTTTTGCCTACAGGGGG - Intergenic
1202869130 14_GL000225v1_random:143565-143587 CTCTGGGCTTTGCCTACAGGAGG + Intergenic
1124553564 15:30706027-30706049 ATCTGGCTCAGGCCTGCAGAGGG - Intronic
1124677680 15:31699641-31699663 ATCTGGCTCAGGCCTGCAGAGGG + Intronic
1125536647 15:40444595-40444617 TCCTGGGTCTGGCCCATAGATGG + Intronic
1125998124 15:44183615-44183637 CTCTGGGCCTGGCCTCCATGTGG - Intronic
1126155396 15:45560992-45561014 CTGTGGTTCTGGCATAAAGAAGG + Intergenic
1126673542 15:51137531-51137553 CACTGGGGCTATCCTACAGATGG - Intergenic
1128752032 15:70156665-70156687 CCCTTGGTCTGGCCTAAATAGGG + Intergenic
1128800913 15:70496281-70496303 CTCTGGATCTGTCCTACCCATGG - Intergenic
1134017372 16:10898566-10898588 CTCTGGGCCTGGCACACAGTGGG - Intronic
1134067829 16:11240657-11240679 CTCTGTGCCTGGCATGCAGAAGG + Intergenic
1134441037 16:14299853-14299875 CTCTGTGCCTGGCACACAGAGGG + Intergenic
1135694081 16:24572182-24572204 CTTCGGGTCTGGCTTCCAGAAGG - Exonic
1136479121 16:30530755-30530777 CCCTGTGTCTGGCCTACCCAGGG - Intronic
1137428404 16:48399015-48399037 CTCTCGTTCTGTCCTCCAGAGGG - Intronic
1137576212 16:49602017-49602039 CACTGGGTCTTGCATACAGTTGG + Intronic
1138957012 16:61983802-61983824 CTCTCTTTCTGGCTTACAGATGG + Intronic
1139081259 16:63524563-63524585 CTCTGGGTCTGGGATAAATAAGG - Intergenic
1139549015 16:67663309-67663331 AGCTGGCTCTGGCCTACAGGGGG + Exonic
1141187354 16:81797482-81797504 CTGTGGGTCAGGACTACCGAAGG - Intronic
1141201310 16:81900544-81900566 CTCTGCATCTGCCCCACAGAGGG - Intronic
1142286662 16:89174220-89174242 CTCTGGGCCAGGCCAACAGCTGG + Intronic
1148540476 17:48476539-48476561 CTCAGGGCCTGGCTTACAGTAGG - Intergenic
1148695636 17:49556505-49556527 CTCCGCCTCTGGCCAACAGAGGG - Intergenic
1148967962 17:51453291-51453313 CTCAGGGCCTGGCATACAGTAGG + Intergenic
1151632266 17:75318996-75319018 CACTGGATCTGGCTTACAGGGGG - Exonic
1151942137 17:77299638-77299660 CTCTGGGTCTCACCTATATAGGG - Intronic
1151959998 17:77400769-77400791 CTGTGGGTCTGGCCTGGGGAAGG + Intronic
1152797298 17:82314653-82314675 CCCTGGGTCTGGCCTCCACCTGG + Intergenic
1155152196 18:23132073-23132095 CTCTGTGGCTGGCATACAGTAGG + Intergenic
1155331364 18:24721871-24721893 CTCTGGATCTCTCCTACACACGG + Intergenic
1155488335 18:26371702-26371724 CTCTAGGTCTGGTGAACAGATGG + Intronic
1156447786 18:37249875-37249897 CTTTGGGTCTGACCTATACAGGG - Intronic
1158326606 18:56319826-56319848 CTCTGGTTCTGGAGTTCAGAAGG - Intergenic
1159030706 18:63228017-63228039 CTCTCTTTTTGGCCTACAGATGG + Intronic
1159220337 18:65454358-65454380 CTCTGGTTCTGGGATCCAGATGG + Intergenic
1160239728 18:77114649-77114671 CGCTGGGACTGGCCTTCGGATGG + Intronic
1161350424 19:3788198-3788220 CACTGGGCCCAGCCTACAGATGG - Intronic
1161460155 19:4391809-4391831 CTCTGTTTCTGGCTTGCAGACGG - Intronic
1161625054 19:5321588-5321610 CTCTGGGCCTGGCACACAGTGGG - Intronic
1163987704 19:20968820-20968842 GCCTGGGCCTGGCCCACAGAAGG + Intergenic
1164211550 19:23102053-23102075 CCCTGGGCCTTGTCTACAGAGGG + Intronic
1165333442 19:35154109-35154131 CCCTGGGTCTGGGGTGCAGACGG - Exonic
1166041362 19:40204814-40204836 CTCTGGGCCTGGCCCAAACAAGG - Intronic
1166299487 19:41905972-41905994 CTCGGGGCCTGGTCTGCAGAAGG - Exonic
1166811329 19:45516272-45516294 CTCTGTGTCTGGCCTATATTGGG - Intronic
1167152761 19:47719325-47719347 CTCTGCGTCTGGGCCACAGATGG + Intronic
1167171985 19:47839549-47839571 CTCTGAGGCTGGGCTCCAGATGG - Exonic
1167411740 19:49348074-49348096 CTCTGCATCTGGCCAGCAGATGG - Intronic
1167506091 19:49871822-49871844 CTCGGGGTCTGACTCACAGAAGG + Exonic
1168563573 19:57403941-57403963 CTCTGTGCTTGGCCTACAGCTGG - Intronic
925415648 2:3668422-3668444 CTCTGGGGCTGGGCTAAGGACGG + Intronic
926551792 2:14310097-14310119 CACTGTGCCTGGCCTGCAGAGGG - Intergenic
927097699 2:19760125-19760147 TTCTGTGTCTGGCTGACAGATGG - Intergenic
927314653 2:21667786-21667808 TTCAAGGTCTGGCCTACAGAAGG - Intergenic
927936538 2:27079507-27079529 CTCTGGGGCTAGGATACAGAGGG - Intronic
928176721 2:29039011-29039033 GTCTGAGCCTGGCCTGCAGATGG + Intronic
932556039 2:72825719-72825741 CTCTGGGTCGGGCCTCCGGCCGG - Intronic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
934623773 2:95832361-95832383 CTCGGGGTCTGGCCCAGTGAGGG - Intergenic
934624118 2:95833805-95833827 CTTGGGGTCTGGCCCACTGAGGG - Intergenic
934809400 2:97267277-97267299 CTCAGGGTCTGGCCCAGTGAAGG + Intergenic
934809590 2:97268101-97268123 CTCAGGGTCTGGCCCAGTGAGGG + Intergenic
934809640 2:97268307-97268329 CTCAGGGTCTGGCCCAGTGAGGG + Intergenic
934828050 2:97489675-97489697 CTCAGGGTCTGGCCCAGTGAAGG - Intergenic
934828206 2:97490292-97490314 CTCAGGGTCTGGCCCAGTGAGGG - Intergenic
935367072 2:102305928-102305950 CTCTGGGGCTGCCCTCGAGATGG + Intergenic
936285367 2:111177191-111177213 CTCTGGGGATGGCCTTCTGATGG + Intergenic
936454777 2:112664393-112664415 CACTGCGTCTGGCCTACTCATGG + Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937991568 2:127664956-127664978 CTCTGGATCTGGCCAACAAATGG + Intronic
939776336 2:146392440-146392462 CCCTGGGTCTGGGCTAGGGAGGG + Intergenic
943101986 2:183497932-183497954 CTCTGGATTTGGCCTTTAGAAGG - Intergenic
945909053 2:215625627-215625649 CTCTGACTCTGACCTAAAGAGGG + Intergenic
946189904 2:218002690-218002712 TTCTGTCTCTGACCTACAGAAGG - Intronic
946838302 2:223794966-223794988 CACTGCGCCTGGCCTGCAGATGG - Intronic
946851261 2:223909202-223909224 CTCTAGGTCTGGCATAGAGCCGG + Intronic
947483531 2:230525565-230525587 CTCTGGCTGCAGCCTACAGAGGG + Intronic
1168869467 20:1116091-1116113 ATCTGTGTCTGGCCCACAGTAGG + Intronic
1168926785 20:1588170-1588192 CTCTGGGTATTGAATACAGAAGG + Intronic
1169900504 20:10547824-10547846 TACTGGGTCTGGCACACAGATGG - Intronic
1171376512 20:24697633-24697655 ATCTGGATCCAGCCTACAGAAGG - Intergenic
1171727854 20:28642157-28642179 CTCTGGGTGTGCCATAGAGAAGG - Intergenic
1172206232 20:33164732-33164754 CACAGGGTCTGGTCTACAGCAGG - Intronic
1172607913 20:36227507-36227529 ATCTGTGTCTTGCCTACAGAAGG + Intronic
1172917907 20:38457560-38457582 CTCGGTGTCTTGCCTCCAGAAGG - Intergenic
1173247769 20:41348136-41348158 CACAGTGTCTGGCCTACAGTAGG - Intronic
1173423814 20:42926112-42926134 CTGTGGGTCTGACCTGCAGAGGG + Intronic
1173507083 20:43596254-43596276 CTCTGGGGCAGGCCTGTAGAGGG + Intronic
1173801599 20:45897889-45897911 GCCTGGCTCTGGCCCACAGAGGG + Intronic
1174593954 20:51668428-51668450 CTCCAGGTCAGGCCTAGAGATGG + Intronic
1174706527 20:52662033-52662055 CTCTGGATCTGGTTCACAGATGG + Intergenic
1175268255 20:57715346-57715368 CTTGGGGTCTGGCCTGCAGTGGG + Intergenic
1176109753 20:63405897-63405919 CTCTGGTCTTGGCCTCCAGAGGG - Intergenic
1178232261 21:30799683-30799705 CTCTGGGTTTGTCCTATATAGGG - Intergenic
1178751932 21:35313217-35313239 TCCTGGGTCAGGCCTACAAATGG - Intronic
1180392211 22:12294663-12294685 CTCTGGGTGTGCCATAGAGAAGG - Intergenic
1180407534 22:12570108-12570130 CTCTGGGTGTGCCATAGAGAAGG + Intergenic
1180621632 22:17166472-17166494 CTGTGGTTCTTGCCTTCAGAAGG - Intergenic
1181147502 22:20859075-20859097 CTCTCGGTCTGGGAAACAGAAGG - Exonic
1181991525 22:26840515-26840537 CTCTGGGCCTGGCACACAGGAGG - Intergenic
1183003559 22:34881241-34881263 CGCTGGGACTGGCCCACAGTTGG - Intergenic
1183371462 22:37434914-37434936 CTCAGGGTCTGGCATGCAGATGG + Intergenic
1184101825 22:42344796-42344818 CTCTGGGCCTGGCCCACAGTAGG + Intergenic
1184208889 22:43023632-43023654 CTCTGAGTCTGGGCCACAGATGG + Intergenic
1185021724 22:48380380-48380402 CTCTGGGTCTGGCCTGGGCAGGG + Intergenic
1185213775 22:49587094-49587116 GCCTGGGACTGGCCTCCAGATGG + Intronic
1185235921 22:49712853-49712875 CTCTGGGTCTAGTCTACAGCAGG + Intergenic
950714124 3:14835844-14835866 TGCAGGGTCTGGCCTGCAGAAGG + Intronic
950808847 3:15632329-15632351 CCCTGGGGCTGGCCCACAGTTGG + Intronic
951107127 3:18757733-18757755 CTTTGGGGCTGGCATATAGAAGG + Intergenic
954201146 3:49024035-49024057 CCCTGGGACTGGCATACACAGGG - Intergenic
954432124 3:50476359-50476381 CACTGGGTCTGGACTTCAAAGGG - Intronic
954527010 3:51280671-51280693 CTCTGGGTCTGGAGCACTGAGGG + Intronic
954544208 3:51419070-51419092 CACTGTGTCTGGCCTAAACATGG - Intronic
954919633 3:54178817-54178839 TTTTGGTTCTGGGCTACAGAGGG + Intronic
954921363 3:54193928-54193950 CTCAGGGTCTGGCCCATAGTTGG + Intronic
967250471 3:187532490-187532512 CACTGAGTGTGGCCTCCAGAGGG + Intergenic
968770416 4:2502261-2502283 CTCAGGGTCTGGCAGAGAGAAGG - Intronic
969449455 4:7264776-7264798 CTCAGGGTCTGGCCTGCAGCTGG - Intronic
969484188 4:7462685-7462707 CTCTGGGTCTGGCACGCAGGAGG + Intronic
974345152 4:60669754-60669776 CTCTGATTCTGGGCTGCAGATGG - Intergenic
974792919 4:66713720-66713742 CACTGGGTGCGGCCCACAGAGGG + Intergenic
978988384 4:115045659-115045681 CACTGAGTCTGTCTTACAGAAGG + Intronic
979901322 4:126221932-126221954 CTCAGAATCTGGCCAACAGATGG + Intergenic
982299041 4:153860045-153860067 CAGTGGGTGTGGCCCACAGAGGG - Intergenic
982337965 4:154260817-154260839 CTCAGGGTCTGGCCTCCAGAAGG + Intronic
985432697 4:189896709-189896731 CTCTGGGTGTGCCATAGAGAAGG + Intergenic
987059751 5:14231220-14231242 CAGAGGGTCTGGCCTAAAGACGG - Intronic
988787359 5:34577354-34577376 CTCTGGGCTGGGCCTGCAGAAGG + Intergenic
992434540 5:76742675-76742697 CTCTGGGTCTGGCTGAAAAATGG + Intergenic
994730707 5:103487501-103487523 CTCTGGGGCAGGGATACAGATGG + Intergenic
998156102 5:139788132-139788154 TTCTGCGTCTGGCCAGCAGAGGG + Intergenic
999221910 5:149987481-149987503 CACTGAGCCTGGCCAACAGATGG - Intronic
999540152 5:152562439-152562461 CTCTGGATCTGGCCCACAGAGGG - Intergenic
1001804266 5:174570053-174570075 GACTGGGTCTGGCCTGCTGAGGG + Intergenic
1002089541 5:176796334-176796356 CTCTGGGGCTGCCCTGCAGGTGG + Intergenic
1004317408 6:14601754-14601776 CTCTGGGTCCAGCCTGCAGCTGG - Intergenic
1006408940 6:33860914-33860936 CTATGGCTCTGGTCTTCAGAAGG - Intergenic
1006582130 6:35083255-35083277 CTGTGGGACTGGCCAGCAGAAGG + Intronic
1007701420 6:43768628-43768650 GCCAGGGTCTGGCCTACAGCTGG - Intergenic
1008364793 6:50665324-50665346 CACTGTGCCTGGCCAACAGAGGG - Intergenic
1010301260 6:74263054-74263076 CACTGTGTCTGGCATATAGAAGG + Intergenic
1010761874 6:79733185-79733207 CTCTCTTTCTGGCTTACAGATGG + Intergenic
1011763736 6:90595921-90595943 CTCTGGGTCTGTCCTCCGGAGGG + Intergenic
1013996500 6:116314998-116315020 CTCTGGGGCTGGAAGACAGATGG - Intronic
1014216489 6:118756908-118756930 CTCTCTCTCTGGCTTACAGATGG + Intergenic
1015952024 6:138562815-138562837 CTCTGGTTATGGCGTGCAGAAGG - Intronic
1018034597 6:159871504-159871526 CGCTGGGTCTGTCCCACTGAAGG - Intergenic
1018343663 6:162879677-162879699 CTCGGGGCCTGGCCCACAGCAGG - Intronic
1019641449 7:2105901-2105923 CTCTGGGACTGTGCTCCAGAAGG - Intronic
1019898630 7:4002231-4002253 CTCTGAGTCTGGGCTCCAGCCGG + Intronic
1023360176 7:39407527-39407549 CTCTGAGACAGGCCTTCAGATGG - Intronic
1023452002 7:40296358-40296380 CTCTTGGGCTGCCCTACAAATGG + Intronic
1024757111 7:52547401-52547423 TGCTGGGTCTGTCCCACAGACGG + Intergenic
1024812409 7:53227696-53227718 CTCTCTGTCTGGCTTGCAGATGG - Intergenic
1025750361 7:64288762-64288784 GCCTGGATCTTGCCTACAGAAGG - Intergenic
1027232124 7:76278851-76278873 CCCTGGGTGTTTCCTACAGAGGG - Intronic
1029288578 7:99484210-99484232 CTCAGCGTCTGGCACACAGAAGG - Intronic
1029973078 7:104808434-104808456 CTCTGTGACTGGCCTACTTAGGG + Intronic
1030655603 7:112163992-112164014 CTCTGGGCCTGGCCAAGATAGGG - Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1035700020 8:1631299-1631321 CCCTGGGTCGGGCTTACAGAAGG + Intronic
1036586583 8:10129815-10129837 CTCTGTGTCTGGCTTGCACAGGG + Intronic
1037334847 8:17782011-17782033 CCTTGGGTCTGGCCAACCGAGGG - Intronic
1038317651 8:26501403-26501425 GTCTGAGTTTGGCCTACAAATGG - Intronic
1038740294 8:30211280-30211302 CTCAGGGTCTGGCACACAGTAGG + Intergenic
1039446083 8:37633966-37633988 CTCTGGAGTTGGCCTGCAGAAGG - Intergenic
1039577060 8:38632183-38632205 CTCTAGGTCTCTCCTAGAGATGG - Intergenic
1041405490 8:57494617-57494639 CACTGGATTTGGCATACAGAAGG + Intergenic
1041405632 8:57496337-57496359 CACTGGATTTGGCATACAGAAGG - Intergenic
1041662380 8:60412844-60412866 CTCTGGCTCTGGTCTGCTGATGG + Intergenic
1042869353 8:73383368-73383390 CTCTGGGTCTTGGCTCCAGCTGG + Intergenic
1045052609 8:98340769-98340791 CCATGGGTCTGTCCTCCAGAGGG - Intergenic
1048995214 8:139789859-139789881 CACTGAGGCCGGCCTACAGAAGG - Intronic
1049182909 8:141232078-141232100 CTCTGCCGCTGGCCTACAGAAGG + Intronic
1049249687 8:141581719-141581741 CTCTGGGCCTGGCACCCAGACGG - Intergenic
1050100711 9:2116331-2116353 TTCTGCATCTGCCCTACAGAAGG - Intronic
1051374706 9:16391314-16391336 CTCTGTGCCTGGCCCACAGTAGG - Intergenic
1052984769 9:34478862-34478884 CTCTGGGTCTGGTCTACAGAAGG - Intronic
1053284650 9:36842351-36842373 CACAGGGTCTGCCCTACACACGG + Intronic
1053380817 9:37648872-37648894 CTCTGGGTTTGGAAGACAGAAGG + Intronic
1053721880 9:40954930-40954952 CTCTGGGTGTGCCATAGAGAAGG + Intergenic
1054344085 9:63897059-63897081 CTCTGGGTGTGCCATAGAGAAGG - Intergenic
1055625990 9:78178279-78178301 CCATGGTTCTGGCCTACAGTGGG + Intergenic
1055690450 9:78824414-78824436 CTCTCTTTCTGGCTTACAGATGG + Intergenic
1056831493 9:89920717-89920739 CTCTCTTTCTGGCTTACAGATGG - Intergenic
1058693590 9:107539910-107539932 CTCTGGCTGTGACCTACAGGTGG - Intergenic
1059044565 9:110851839-110851861 CTCAATGTCTGGCCTAGAGAAGG - Intergenic
1060779140 9:126398947-126398969 CTCAGGTGATGGCCTACAGACGG - Intronic
1061697245 9:132385777-132385799 CTCTGTGCCTGGTATACAGAAGG + Intronic
1061713017 9:132500408-132500430 CACAGGGCCTGGCCTACAAAGGG + Intronic
1062064429 9:134518477-134518499 CTCTGGGCCTGGCCTGCGGGCGG + Intergenic
1062443148 9:136582482-136582504 CTCTGTGTCTGGTGTACAGCTGG - Intergenic
1062502065 9:136855916-136855938 CTCTGCCTCTGCACTACAGAGGG + Intronic
1203735743 Un_GL000216v2:137577-137599 CTCTGGGCTTTGCCTACAGGAGG - Intergenic
1203739875 Un_GL000216v2:170052-170074 GTCTGGGTTTTGCCTACAGGGGG + Intergenic
1203453283 Un_GL000219v1:141074-141096 CTCTGGGTGTGCCATAGAGAAGG - Intergenic
1203421130 Un_KI270448v1:7187-7209 CTCTGGGTGTGCCATAGAGAAGG + Intergenic
1203421702 Un_KI270521v1:6702-6724 CTCTGGGTGTGCCATAGAGAAGG + Intergenic
1186461500 X:9751968-9751990 CTCTGGGGCTGGCCCCCAGCAGG - Intronic
1186940063 X:14496863-14496885 CTCTGGTGCTGGCCTTCAGCTGG + Intergenic
1190736654 X:53259911-53259933 CACTGTGCCTGGCATACAGAGGG - Intronic
1193730743 X:85099915-85099937 CACTGGGCCTGGCCTATGGATGG - Intronic
1196595264 X:117538629-117538651 CTTTGGTGCTGGCATACAGAAGG + Intergenic
1198517970 X:137427696-137427718 CACTGGGTCTGGCACACAGTAGG - Intergenic
1199638133 X:149832956-149832978 CTCAGGGGCTGGCCCACAGGGGG - Intergenic
1200122045 X:153795670-153795692 CTCTGGGTCTGGACCACAGGAGG - Intronic