ID: 915895214

View in Genome Browser
Species Human (GRCh38)
Location 1:159806739-159806761
Sequence TGGCCAAGACTCCTGAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 202}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915895214_915895221 2 Left 915895214 1:159806739-159806761 CCCTTCCTCAGGAGTCTTGGCCA 0: 1
1: 0
2: 1
3: 20
4: 202
Right 915895221 1:159806764-159806786 TCCTAGGAAAAGGAGGAACTTGG 0: 1
1: 0
2: 3
3: 31
4: 338
915895214_915895224 26 Left 915895214 1:159806739-159806761 CCCTTCCTCAGGAGTCTTGGCCA 0: 1
1: 0
2: 1
3: 20
4: 202
Right 915895224 1:159806788-159806810 ACTCCACTAGTCTAAGGCCAAGG 0: 1
1: 2
2: 1
3: 3
4: 92
915895214_915895225 27 Left 915895214 1:159806739-159806761 CCCTTCCTCAGGAGTCTTGGCCA 0: 1
1: 0
2: 1
3: 20
4: 202
Right 915895225 1:159806789-159806811 CTCCACTAGTCTAAGGCCAAGGG 0: 1
1: 0
2: 0
3: 6
4: 87
915895214_915895218 -8 Left 915895214 1:159806739-159806761 CCCTTCCTCAGGAGTCTTGGCCA 0: 1
1: 0
2: 1
3: 20
4: 202
Right 915895218 1:159806754-159806776 CTTGGCCAGTTCCTAGGAAAAGG 0: 1
1: 0
2: 0
3: 5
4: 146
915895214_915895219 -5 Left 915895214 1:159806739-159806761 CCCTTCCTCAGGAGTCTTGGCCA 0: 1
1: 0
2: 1
3: 20
4: 202
Right 915895219 1:159806757-159806779 GGCCAGTTCCTAGGAAAAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 173
915895214_915895223 20 Left 915895214 1:159806739-159806761 CCCTTCCTCAGGAGTCTTGGCCA 0: 1
1: 0
2: 1
3: 20
4: 202
Right 915895223 1:159806782-159806804 CTTGGAACTCCACTAGTCTAAGG 0: 1
1: 0
2: 0
3: 7
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915895214 Original CRISPR TGGCCAAGACTCCTGAGGAA GGG (reversed) Intronic
900826546 1:4931627-4931649 TGGCCATGACTCATGAGGACTGG + Intergenic
901674029 1:10872483-10872505 TGGCCAGGAGTCCAGAGGAGAGG + Intergenic
902118606 1:14142578-14142600 CTGCCAAGACTCCTGAGTGAAGG + Intergenic
902719962 1:18297310-18297332 TGAACAAGACACCTTAGGAAAGG + Intronic
903816583 1:26068271-26068293 TGCCCAGGACTCCAGAGGAGGGG - Intronic
904412920 1:30335836-30335858 AGGCCAAGAGTACTGAGGACTGG + Intergenic
905328573 1:37175905-37175927 TGGCCCAGAATCCTTGGGAAGGG - Intergenic
906488641 1:46250338-46250360 TGGTTCAGATTCCTGAGGAAAGG + Intronic
907295545 1:53450062-53450084 TAGCCCAGACTCCTCAGGTATGG - Intergenic
908301351 1:62763617-62763639 GGATCAAGACTCCTGAGGAATGG + Intergenic
909606437 1:77513255-77513277 TGGCTGGGACTCCTTAGGAAGGG - Intronic
911375910 1:97051372-97051394 TGGCTAAGAACCCTGAGCAATGG + Intergenic
911727537 1:101257943-101257965 TTGCCTAGAGTCCTGGGGAAGGG + Intergenic
912866159 1:113258641-113258663 TGGCCAAGATTGATGAGCAATGG - Intergenic
915895214 1:159806739-159806761 TGGCCAAGACTCCTGAGGAAGGG - Intronic
917185519 1:172350241-172350263 TGCCAAAAAGTCCTGAGGAAGGG - Intronic
918650003 1:186950751-186950773 TGGCCCAGATCCATGAGGAAAGG + Intronic
920341634 1:205278803-205278825 AGGGCAAGATACCTGAGGAAGGG + Intergenic
922860069 1:228808991-228809013 TGGCCAAGAGTTCTGAGATAAGG + Intergenic
923230845 1:231984800-231984822 TGGCCAAGACAGCTGAGGAAAGG + Intronic
923639431 1:235738907-235738929 TGACTCTGACTCCTGAGGAAGGG + Intronic
924492193 1:244549200-244549222 TGGCCCAGACACTTTAGGAATGG + Intronic
1063112413 10:3048463-3048485 TGGCCAAGAAGCCCGGGGAACGG + Intergenic
1064784485 10:18878625-18878647 TGGCCCAGACTCTTCAGGAAAGG + Intergenic
1064895155 10:20227403-20227425 TGGGCAGGATTTCTGAGGAAAGG + Intronic
1070639290 10:78155040-78155062 TGTCCAAGCCTACTGAGGACAGG + Intergenic
1071902958 10:90140630-90140652 TGGCCAAGGCTCCTGAGCATTGG + Intergenic
1072209001 10:93229793-93229815 TGGCCCAGACCCTTCAGGAATGG - Intergenic
1073114124 10:101081395-101081417 TGGGCAGGACTCCTGGGGAAGGG + Intergenic
1075711431 10:124532856-124532878 TGGCAAAGTGTCCCGAGGAAGGG + Intronic
1076077039 10:127542069-127542091 TGGCCCTGACTTCTGAGGCAAGG - Intergenic
1076119386 10:127923291-127923313 TAGCCAAGACTCCTGGGGCCAGG - Intronic
1076441633 10:130484656-130484678 TGGCCCAGGCTGCTGAGGGAGGG + Intergenic
1078748549 11:14138544-14138566 TGGCCAGGACACCTGGGGACTGG + Intronic
1079027606 11:16961246-16961268 TGACCAAGGCTCCAGAAGAAAGG + Intronic
1080446806 11:32345153-32345175 TGTCCAAGGCTCCAAAGGAAGGG + Intergenic
1080730210 11:34943104-34943126 TGGCCATGAAACCTGAGGAATGG + Intronic
1082894458 11:58175366-58175388 TGGGCAAAACTCTTTAGGAAAGG - Intronic
1083170961 11:60923946-60923968 TGCCCAACACTCCCGAGGGAAGG - Intergenic
1084131843 11:67142150-67142172 TGGCTCAGCCTCCTGAGTAATGG + Intronic
1085748467 11:79136548-79136570 TGGCTAATAATCCTGAGGAATGG - Intronic
1085788918 11:79478940-79478962 TGGAGGAGAATCCTGAGGAATGG - Intergenic
1087577690 11:100010376-100010398 GGACCAAGAATTCTGAGGAATGG + Intronic
1088940756 11:114453462-114453484 TAGCCCAGCCTCCTGAGGAGTGG - Intergenic
1089576827 11:119450489-119450511 TGGCCAATTCTCTTGAAGAAAGG + Intergenic
1090273500 11:125404066-125404088 TGGCTAAGCATCCTGAGGACAGG + Intronic
1091800370 12:3321169-3321191 TCGCCAACACTGCAGAGGAAAGG + Intergenic
1092034117 12:5316019-5316041 TGTCCAAGACTGCTGTGTAAGGG + Intergenic
1092069671 12:5622502-5622524 TGGCCGAGACTTCTGGGAAAGGG + Intronic
1092093888 12:5825834-5825856 TGGCCCAGACCCCTCAGGAATGG + Intronic
1092523278 12:9294360-9294382 TGGCCCAGACTCCTTAGGAGAGG + Intergenic
1092544016 12:9437539-9437561 TGGCCCAGACTCCTTAGGAGAGG - Intergenic
1094508933 12:31084510-31084532 TGGCCCAGACTCCTTAGGAGAGG + Intronic
1094656201 12:32421660-32421682 AGGTCAAGACTCCTGATAAAAGG + Intronic
1096515479 12:52153008-52153030 AGGGCAAGGCTCCTCAGGAACGG + Intergenic
1098078834 12:66761659-66761681 TGGGCTAGACTCCAAAGGAAAGG - Intronic
1099482910 12:83190740-83190762 TGACCAACACTCATGAGGAAAGG - Intergenic
1100658692 12:96674265-96674287 TGCCAATGACTCCTGAGAAAGGG - Intronic
1101261661 12:103038185-103038207 TGGCCAAAACTTCTTAAGAAAGG - Intergenic
1102918690 12:116775433-116775455 AGGCTAAGACTCCTTAGCAAGGG - Intronic
1103339793 12:120215293-120215315 TGGTCAGGACTCCTGAGGCTCGG + Exonic
1105391764 13:19986073-19986095 TGTCTCAGACTCCTGAGTAACGG - Intronic
1105651102 13:22379007-22379029 TGGCCAAGAATATAGAGGAAGGG + Intergenic
1108225896 13:48288527-48288549 TGCACAAGAATTCTGAGGAATGG - Intergenic
1108499989 13:51061031-51061053 TGGCCAAGACTGCACAGCAAGGG - Intergenic
1109009529 13:56922665-56922687 TGGCCCAAACTCTTCAGGAATGG + Intergenic
1116059150 14:39898785-39898807 TGACCCAGACACCTCAGGAATGG + Intergenic
1117025977 14:51620632-51620654 TGGACAAGACTTCTTGGGAAAGG - Intronic
1118770042 14:68936685-68936707 TGGGCAAGAAGCCGGAGGAAAGG + Intronic
1120911697 14:89672719-89672741 TGGGCAGGACGCCTGAGAAATGG - Intergenic
1121262389 14:92575969-92575991 TGGCCAAGGTTGCTGAAGAAAGG - Intronic
1122501180 14:102200879-102200901 TGGCCCTGACTCCTGGGGTATGG + Intronic
1124193179 15:27598038-27598060 TGACCAAGCCTCCTTGGGAATGG + Intergenic
1125957667 15:43801359-43801381 CTGCCAAGACTCCAGGGGAAAGG + Intronic
1126150715 15:45521909-45521931 TGACAAAGACTCTCGAGGAAAGG + Intronic
1129167933 15:73789500-73789522 TGCCCAGAGCTCCTGAGGAAGGG + Intergenic
1130809391 15:87360548-87360570 TAGCCAAGGCTGCTGAGAAATGG - Intergenic
1131091523 15:89628084-89628106 TGGCCAAGAATCATCACGAAAGG - Exonic
1131177630 15:90219965-90219987 TAGCATAGACCCCTGAGGAAAGG + Intronic
1133125484 16:3643218-3643240 GGGCCAAGACCCCTGAGCGAAGG + Intronic
1133280596 16:4662937-4662959 TGACTAAGACCCATGAGGAAGGG - Intronic
1136482033 16:30548073-30548095 TGGTCAAGGGTTCTGAGGAACGG + Intronic
1136492979 16:30622746-30622768 TGGCCACAATTCCAGAGGAAGGG - Intronic
1139110663 16:63886659-63886681 TCACCAAGCCACCTGAGGAAGGG - Intergenic
1139968141 16:70756838-70756860 CGGCCATGACTCAGGAGGAAAGG - Intronic
1140784265 16:78325027-78325049 TGGCCAAGGAATCTGAGGAATGG - Intronic
1140888365 16:79264054-79264076 TGGAGAAGACTCCAGGGGAATGG + Intergenic
1142738512 17:1917029-1917051 CGGCCAAGTGTCCGGAGGAAGGG + Intergenic
1143388262 17:6544980-6545002 TGGCCGAGGCTCCTGCGGACAGG + Intronic
1144530576 17:16034858-16034880 TGGGCAAGGCTACTTAGGAACGG - Exonic
1146590385 17:34123428-34123450 GGGGCCAGACTCCTGGGGAATGG + Intronic
1147843357 17:43388342-43388364 TGGCCACGCCTCCTGGGAAAGGG - Intergenic
1148856239 17:50580627-50580649 TTGCTCAGGCTCCTGAGGAAGGG + Intronic
1149666954 17:58371548-58371570 TGACCCAGCCTCCTGAGAAATGG - Intronic
1151514747 17:74585977-74585999 GGGCCACAATTCCTGAGGAAGGG + Intronic
1151573069 17:74936680-74936702 GGGCAAAGACCCCAGAGGAAGGG + Intronic
1152279882 17:79379018-79379040 TGGCCATGCCTCCTGGGGAGGGG + Intronic
1152381088 17:79942550-79942572 AGGCCAGGCCTTCTGAGGAAGGG - Intronic
1153476567 18:5505010-5505032 TGGGCAAGACTGCTGAGTGAAGG - Intronic
1154332547 18:13441627-13441649 TGGCCAAGACATCTGAGCCATGG - Intronic
1154506409 18:15044756-15044778 TGGCCCAGACCCTTCAGGAATGG + Intergenic
1155539580 18:26854466-26854488 TGGCCACGCCCCCTGAGAAAGGG + Exonic
1157119771 18:44898031-44898053 GTGCCCAGACTTCTGAGGAATGG + Intronic
1162786875 19:13040538-13040560 AGGCCAGGGCTCCTGAGGAGAGG - Intronic
1163203862 19:15787972-15787994 TGGCCACGACTGCTGTGGAAAGG - Intergenic
925966403 2:9071097-9071119 TGGCAGAGACACCGGAGGAATGG - Intergenic
926290358 2:11524380-11524402 TGTCCATGACTCTTGAGGACAGG + Intergenic
926865298 2:17350417-17350439 AGTCCAAGATTCCTAAGGAAAGG + Intergenic
927688298 2:25188339-25188361 TGGCCAGGGCTCCTGAGGCTGGG - Intergenic
928196890 2:29222596-29222618 TGGCCCAGACCCCTGTGCAAAGG + Exonic
929204445 2:39275187-39275209 TGGCCAGGACTCTTGAGAGAAGG - Intronic
929624626 2:43393903-43393925 TGGCCACCAATCATGAGGAAGGG - Intronic
930910388 2:56622747-56622769 TGGCCCAGACCCTTCAGGAATGG + Intergenic
935087527 2:99862585-99862607 TGGCCCAAATTACTGAGGAAAGG + Intronic
935333498 2:101994628-101994650 TGGACACGTCTCCTAAGGAAAGG - Intronic
937280810 2:120716107-120716129 TGGCCAGGACTGCTGAGGAGTGG - Intergenic
938102702 2:128507914-128507936 TGTCCAAGACTCCCCAGTAAAGG - Intergenic
941758931 2:169219560-169219582 TAGCAAGGAATCCTGAGGAAGGG - Intronic
941808477 2:169733549-169733571 TGGCGAAGCCTACTGAGGGAGGG + Intronic
946916133 2:224524155-224524177 GGGCCAAGATTCCGGAGAAAAGG + Intronic
947307332 2:228762097-228762119 TGGCTAAGACTCAAGAGCAAAGG + Intergenic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1170800045 20:19583308-19583330 TGGCCAAGTATTTTGAGGAAGGG + Intronic
1170889299 20:20365133-20365155 TGGCCAGGACCCCGAAGGAAGGG + Intergenic
1175515783 20:59568923-59568945 TGGCCCAGACTGCTGGGGAGGGG + Intergenic
1176791446 21:13324267-13324289 TGGCCCAGACCCTTCAGGAATGG - Intergenic
1178504116 21:33149389-33149411 TGGCCCAGCCTCATTAGGAAGGG + Intergenic
1179610526 21:42547403-42547425 TGGCCAGGCCTCCTCAGGAGTGG + Intronic
1181639313 22:24188462-24188484 AGGCCAAGACTCCTGAGAACAGG + Exonic
1181937376 22:26448545-26448567 GGGCCAAGCACCCTGAGGAAAGG - Intronic
1182683031 22:32097283-32097305 TGGGAAAGGCTCCTGGGGAAGGG + Intronic
1183098762 22:35570593-35570615 TGGCGAGGCCTCCTGGGGAAGGG + Intergenic
1184946036 22:47804855-47804877 TGGCCAAGAGCCATGAGCAACGG + Intergenic
1185131224 22:49040191-49040213 TGGCCAGGATTCCTGTTGAACGG - Intergenic
951952628 3:28217295-28217317 TGAGCATGTCTCCTGAGGAAGGG - Intergenic
954717113 3:52532439-52532461 TGGTAAAGGCCCCTGAGGAATGG - Intronic
955091217 3:55752503-55752525 TTGCCAAGACTGCTGAACAAGGG + Intronic
955134123 3:56199194-56199216 AGGCCAAGAATGCTGGGGAAGGG + Intronic
958673238 3:97231875-97231897 TTGACAAGACTCCTAGGGAAGGG + Intronic
959840487 3:110969102-110969124 TTGGCAAGCCTCCAGAGGAAGGG - Intergenic
960352883 3:116615084-116615106 TGTCCATGCCTCCTTAGGAAGGG - Intronic
962005239 3:131343016-131343038 GGGCCAAGACTCAAGAGGAGTGG + Intronic
964171916 3:153781047-153781069 TCCGCCAGACTCCTGAGGAAGGG - Intergenic
964607002 3:158570992-158571014 TCGCCAAGGCTCCTGTGGGATGG - Intergenic
964738683 3:159943161-159943183 TGGGACAGACTCCTGAGCAAAGG + Intergenic
966512815 3:180783101-180783123 TGGCCTGGAATCTTGAGGAAGGG + Intronic
976346790 4:84012936-84012958 TGTCCAAGAGACCTGAGCAAAGG + Intergenic
976774316 4:88690511-88690533 TAGGCAAGCATCCTGAGGAAGGG + Intronic
977001773 4:91513423-91513445 TGGCAAAGACTCATGGGAAAAGG - Intronic
981548701 4:145920479-145920501 TGGGCAAGTCTCCTCAGGAAGGG + Intronic
984571545 4:181400516-181400538 TAGTCAAGACACCTGAGGAAAGG + Intergenic
984873897 4:184350505-184350527 TGGCCCAGCCTCCTGAAGAGGGG + Intergenic
990062147 5:51664622-51664644 GGGCCAAGACTGCAGAGAAAGGG - Intergenic
990104032 5:52233676-52233698 TGGGAAAGACTCATGAAGAAAGG + Intergenic
990168660 5:53022535-53022557 TGGTCAGGAATCCTCAGGAAAGG + Intronic
993250766 5:85519259-85519281 GAGCCAAGACTGCTGAGGACTGG - Intergenic
997935903 5:138110717-138110739 TGCCCAGGACGCCTGAGGAAGGG + Intergenic
999847053 5:155494804-155494826 TGGAAAGTACTCCTGAGGAATGG + Intergenic
1005033561 6:21534677-21534699 TTTTCAAGACACCTGAGGAACGG - Intergenic
1006168784 6:32081357-32081379 TGGCCAAGACTGGTGAGTCATGG - Intronic
1006576917 6:35053290-35053312 TGGCCAGGTTTCCTGGGGAAGGG + Intronic
1007794815 6:44338989-44339011 CTGCCAAGACTCAAGAGGAATGG + Intronic
1007947634 6:45840303-45840325 TGACCCAGCCTGCTGAGGAATGG + Intergenic
1010753738 6:79643404-79643426 TGTGCAGGACTCCTGAGGAGTGG + Intronic
1010812974 6:80321415-80321437 TGAACAGGACTCCTGTGGAATGG + Intronic
1016933123 6:149428554-149428576 TGGCAAGGACTCCAGAGGATGGG - Intergenic
1019004844 6:168788121-168788143 TGCCCAACACTGCAGAGGAAAGG - Intergenic
1019111136 6:169715029-169715051 AGGCCTATTCTCCTGAGGAATGG + Intronic
1019289996 7:245731-245753 AGGCCAATACTCCAGGGGAAGGG - Intronic
1019826641 7:3289977-3289999 CAGCCCAGACTCCAGAGGAATGG - Intergenic
1020280639 7:6648310-6648332 TGGCCCAGCCTCAAGAGGAAAGG + Intronic
1021028882 7:15704196-15704218 TGGCCCAAACTCTTCAGGAATGG + Intergenic
1022285663 7:28955163-28955185 TGGCCAAGCCTCCTTTGTAATGG + Exonic
1023127294 7:36967376-36967398 TGGGCCACACTCCTGAGGTAGGG + Intronic
1023292521 7:38683182-38683204 TGTGCAAGACTCCTGTGGCAAGG + Intergenic
1023880941 7:44321064-44321086 TGGCCAAGGCCCCCGAGGCAGGG + Intronic
1027047624 7:75001514-75001536 TGGCCATGACTCATTAGAAAAGG + Intronic
1029385368 7:100240125-100240147 TGGCCATGACTCATTAGAAAAGG - Intronic
1029737579 7:102473159-102473181 TGGACAAGAAGCCTGTGGAAAGG + Exonic
1031010176 7:116518289-116518311 CAGCCAAGAATTCTGAGGAAAGG + Intergenic
1031808443 7:126336180-126336202 GGCCCAAGACTCCCAAGGAATGG - Intergenic
1034202910 7:149293596-149293618 TGGGCGAGGCTCCTGAGGGAAGG + Intronic
1034566822 7:151922048-151922070 GGGCCAAGATCCCTGAGGCAAGG + Intergenic
1035662649 8:1359489-1359511 TGGCCTAGCCTCCTGGCGAAGGG + Intergenic
1035840793 8:2810234-2810256 AGGAAAAGACCCCTGAGGAAGGG - Intergenic
1036781059 8:11647964-11647986 TTGCCAAAAATCTTGAGGAAGGG + Intergenic
1037845311 8:22277133-22277155 TGCCTCAGACTCCTGAGGAGGGG + Intronic
1038230570 8:25695406-25695428 TGGGCAAGATTACTGTGGAAAGG + Intergenic
1038313839 8:26466142-26466164 TTGCCAAGACCGCAGAGGAAGGG + Intronic
1039960060 8:42239367-42239389 GGGCCAGGCCACCTGAGGAATGG - Intergenic
1040419387 8:47224718-47224740 AGGCCAGGACCCCTGAGGCATGG + Intergenic
1040987956 8:53317191-53317213 TAGCCAACACTCCCGAGAAATGG - Intergenic
1041407132 8:57512334-57512356 AGGCCAAGACTTCAGAGGAGGGG - Intergenic
1043323420 8:79019040-79019062 TGGCTGAGACTTCTGAGTAAAGG - Intergenic
1044330135 8:90909465-90909487 TTTCTAAGATTCCTGAGGAAGGG + Intronic
1047556636 8:125939135-125939157 GGGCCGAGACTCCTCAGGGATGG + Intergenic
1048430089 8:134362125-134362147 TGGCCAGGGCCACTGAGGAAAGG + Intergenic
1049054259 8:140222538-140222560 TCGCAGAGTCTCCTGAGGAAAGG + Intronic
1051804045 9:20971551-20971573 TGCCCCAGCCTCCTGAGTAACGG + Intronic
1052794232 9:32908261-32908283 TAGCCAAGATTCCTGAAGAGAGG + Intergenic
1055564840 9:77557946-77557968 TGGCTATGAGGCCTGAGGAAAGG - Intronic
1060530054 9:124342706-124342728 GGGACAAGACACATGAGGAAAGG - Intronic
1062109221 9:134772955-134772977 TGGCGGAGACACCTGAGGAAGGG - Intronic
1062631678 9:137465865-137465887 TGGCCACGTCTGCTGGGGAACGG + Intronic
1186871800 X:13781165-13781187 AGGCCAGGACTCCAGAGGGAAGG + Intronic
1187190981 X:17034826-17034848 TAGCTAAGCCCCCTGAGGAATGG - Intronic
1187282268 X:17866820-17866842 AGGGCAAGACTCCTGTGCAAGGG + Intergenic
1187959879 X:24558431-24558453 TGGCCAAGACTAGTGCTGAACGG + Intronic
1188107375 X:26160776-26160798 TCCCTGAGACTCCTGAGGAACGG - Intergenic
1188110770 X:26194022-26194044 TCCCTGAGACTCCTGAGGAATGG - Exonic
1188110790 X:26194148-26194170 TCCCTGAGACTCCTGAGGAACGG - Exonic
1188110808 X:26194274-26194296 TCCCTGAGACTCCTGAGGAACGG - Exonic
1190742007 X:53295187-53295209 TGGCCATCACTGCTGAGGATGGG - Intronic
1190753275 X:53380457-53380479 TGGCTAAGCCTCCAGAGGCAGGG + Intronic
1192195328 X:69024045-69024067 TGGCTCAGAGTCCTGAGAAAGGG - Intergenic
1192661333 X:73045913-73045935 TGGCCCAGACCCCTCAGGAATGG - Intergenic
1194649095 X:96493918-96493940 TGGCCTAGACTCATAAGGATTGG - Intergenic
1195937129 X:110136607-110136629 AGGCCAAGTCACCTGAGGTATGG + Intronic
1197050491 X:122052082-122052104 GGGCCAAAACTCCAGAGAAAAGG - Intergenic
1200072221 X:153534912-153534934 TGGCCCAGAGCCCTGAAGAAAGG - Intronic
1202167311 Y:22003510-22003532 TGGCAAGGACTCCTGCAGAATGG + Intergenic
1202224049 Y:22582859-22582881 TGGCAAGGACTCCTGCAGAATGG - Intergenic
1202319066 Y:23612802-23612824 TGGCAAGGACTCCTGCAGAATGG + Intergenic
1202551703 Y:26057255-26057277 TGGCAAGGACTCCTGCAGAATGG - Intergenic