ID: 915895941

View in Genome Browser
Species Human (GRCh38)
Location 1:159810905-159810927
Sequence ATGTGCCAGTCTAATACATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915895941_915895944 29 Left 915895941 1:159810905-159810927 CCTCATGTATTAGACTGGCACAT 0: 1
1: 0
2: 1
3: 2
4: 90
Right 915895944 1:159810957-159810979 TCTGAGAAGATCACCCCAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915895941 Original CRISPR ATGTGCCAGTCTAATACATG AGG (reversed) Intronic
900801399 1:4739132-4739154 ATGTCCCACTCAAACACATGTGG + Intronic
905243218 1:36594925-36594947 ATGTGAAATTCTGATACATGAGG + Intergenic
907910661 1:58823198-58823220 ATGTACCTGTATATTACATGTGG + Intergenic
915895941 1:159810905-159810927 ATGTGCCAGTCTAATACATGAGG - Intronic
917029781 1:170677259-170677281 ATGTGCCAGTTTTATAGATGAGG - Intronic
917384965 1:174462566-174462588 ATGTGCAAGTTTATTACTTGGGG + Intronic
917550889 1:176027789-176027811 TTGTGCCACTCTAAAACATTTGG + Intronic
922317532 1:224456059-224456081 ATGTGCCAGTTTAGCAGATGTGG + Intronic
923452550 1:234132991-234133013 TTGTGCCAGTTTTATAGATGAGG + Intronic
923607154 1:235454337-235454359 ATGTGTCAGACTAACACAAGAGG - Intronic
1063248855 10:4252255-4252277 ATCTTCCAGGCTAATACATCAGG + Intergenic
1063453561 10:6167476-6167498 ATGTGACAATTTAATAAATGTGG - Intronic
1066147918 10:32581510-32581532 TTGTGCCAGTCAAAGAGATGTGG - Intronic
1067294528 10:44967717-44967739 ATGTGCCAGGCTTATGCTTGGGG + Intronic
1070106679 10:73439239-73439261 ATGTGCCAGACTAAGACCTAAGG - Intronic
1072463783 10:95644631-95644653 GTGTGCCTGGCTAATACTTGGGG - Intronic
1073522145 10:104142701-104142723 ATATGCCAGCCTGATGCATGTGG + Intronic
1074892230 10:117745236-117745258 ATGTGCAAACCTAATACATTGGG - Intergenic
1079502612 11:21118528-21118550 ATTTGCCTGTGTAATAAATGAGG + Intronic
1079629952 11:22662217-22662239 GTGTGCCAGGCTTATAAATGAGG - Intronic
1081392144 11:42541730-42541752 CTGTGCCAGTCTGATATGTGTGG - Intergenic
1085839917 11:79999938-79999960 ATGTGCAAGTCTAAAAGTTGGGG + Intergenic
1089008411 11:115112711-115112733 ATGTGCCAGGCTCCTACCTGTGG - Intergenic
1090578785 11:128137578-128137600 TTGTGCTATTCTAATACCTGTGG + Intergenic
1092449805 12:8591510-8591532 CTGTCCCAGGCTATTACATGTGG + Intergenic
1093855547 12:24097691-24097713 ATGTACCAATCCTATACATGAGG - Intergenic
1094751254 12:33411765-33411787 ATATGCCACTCTAATGCATTAGG + Intronic
1096950741 12:55467073-55467095 ATGTTCCAGTCTACCATATGAGG + Intergenic
1097307343 12:58084051-58084073 ATCTGCCAGTATCATCCATGAGG - Intergenic
1099350411 12:81561483-81561505 ATGTGCCAGGGTAATACAGGAGG + Intronic
1100257521 12:92899569-92899591 ATGTGCCTGTGTAATGCATCAGG - Intronic
1102135869 12:110574251-110574273 ATGTGTCAGTTTTATAGATGAGG + Intronic
1105619663 13:22054654-22054676 ATCAGCCAGTCCAATAAATGTGG - Intergenic
1106204707 13:27581722-27581744 AAGTGGAAGTCTAACACATGAGG - Exonic
1111317852 13:86584679-86584701 CTGTCCCTGACTAATACATGGGG + Intergenic
1117975544 14:61293035-61293057 ATGTGCCACTTTATTACATAGGG - Intronic
1119535595 14:75400328-75400350 ATGTGCCAGGCTAGTCCCTGGGG - Intergenic
1124718605 15:32091986-32092008 GTATGCCAGGATAATACATGGGG - Intronic
1127183971 15:56458397-56458419 ATGTACCAGTCTAATGGAGGAGG - Intronic
1134178339 16:12027073-12027095 CTGTGCCAGTCTGATGCATATGG + Intronic
1138747699 16:59382868-59382890 ATTTCCCAGTCTAAGACAAGAGG - Intergenic
1143554186 17:7650715-7650737 CTGTCCCAGTCTAGTACCTGGGG + Intronic
1146464198 17:33073478-33073500 CTGTGCCCATCTTATACATGGGG - Intronic
1155507414 18:26547387-26547409 CGGTGCCCGTCTCATACATGCGG + Intronic
1158403907 18:57144492-57144514 AGGTGCCTATGTAATACATGAGG + Intergenic
926550637 2:14296653-14296675 ATGTGCCAGTGTCAAACATAGGG - Intergenic
926847549 2:17159028-17159050 ATTTGCTATTCTAATACATCAGG + Intergenic
927038948 2:19208691-19208713 CTGAGCCAGTCTAAGCCATGAGG - Intergenic
933860346 2:86460495-86460517 AAGTGCCAGTCCAACACATCTGG - Intronic
933898310 2:86831384-86831406 ATGTAGCAGTCACATACATGGGG - Intronic
935608964 2:105001237-105001259 AGGCACCAGTCTAATACCTGTGG + Intergenic
940849806 2:158677245-158677267 ATGAGCCAGTCTAGAAGATGTGG - Intronic
946581619 2:221134188-221134210 ATGTGCCAGGCTAATGCAATGGG - Intergenic
948758665 2:240175812-240175834 ATGTTCTTGTCTAATAAATGAGG - Intergenic
1175446713 20:59025278-59025300 AGGTGCCTGACTAGTACATGGGG + Exonic
951913790 3:27778103-27778125 ATGTGACAGCCTAATAAAGGAGG + Intergenic
963079204 3:141375686-141375708 AAGTGCCAGACTAAAATATGTGG + Intronic
964923074 3:161921574-161921596 ATATGCCACTCCAATACAGGTGG + Intergenic
966585311 3:181617176-181617198 AAGGGCCAGTCTGACACATGTGG - Intergenic
969677289 4:8621078-8621100 TTGTGCCAGTGTAAGACTTGAGG - Intergenic
969678241 4:8626716-8626738 TTGTGCCAGTGTAAGACTTGAGG - Intergenic
969679197 4:8632354-8632376 TTGTGCCAGTGTAAGACTTGAGG - Intergenic
970875164 4:20860858-20860880 ATGTTCAAGTCTGATACATCAGG + Intronic
972830400 4:42808205-42808227 ATGTGCCAGTTTGTTACATAGGG + Intergenic
979763613 4:124437264-124437286 ATGTGCAATTCAAATATATGTGG + Intergenic
982612808 4:157597992-157598014 CTGTGCCAGTTTAGAACATGAGG + Intergenic
982928100 4:161365674-161365696 ATGTGGAAATCAAATACATGAGG - Intergenic
984152381 4:176150256-176150278 ATGTACCATTCTAATTCATTGGG + Intronic
985277584 4:188252994-188253016 ATGTGCAAGTGTAAAACCTGGGG + Intergenic
987451565 5:18090522-18090544 ATGTTCGAACCTAATACATGAGG - Intergenic
988860417 5:35271815-35271837 ATCCTCCAGTCTACTACATGGGG + Intergenic
996970121 5:129357014-129357036 ATGTGTCATTAGAATACATGAGG + Intergenic
1002195153 5:177497301-177497323 CGGGGCCAGTCTAATGCATGGGG - Intronic
1004958580 6:20758789-20758811 ATTTGCCAGTCTAATATTGGAGG + Intronic
1013822409 6:114171271-114171293 ATGAGTCAGTCCAATAAATGTGG + Intronic
1013864111 6:114673744-114673766 ATAGGCCAGTCCAATACATAAGG - Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1017278420 6:152596810-152596832 ATTTGACAGTCAAATACATTTGG + Intronic
1018498469 6:164376577-164376599 TTTTGCCAGTCTAATTTATGGGG - Intergenic
1020741829 7:12029936-12029958 ATGTGCCACTTTCATGCATGAGG - Intergenic
1024282813 7:47733443-47733465 AAGTGCCAGTCAACTCCATGAGG + Intronic
1025761651 7:64401447-64401469 ATGTGACAGACTAATACATGTGG - Intergenic
1035473601 7:159127532-159127554 CTGAGTCAGTCCAATACATGTGG + Intronic
1036649968 8:10635940-10635962 CTGTGCCAGTCTCTTCCATGGGG - Intronic
1037518766 8:19660021-19660043 TTGTCCCAGTCTTATAGATGGGG + Intronic
1038922904 8:32105044-32105066 ATGTGCTAGACTCATACAAGTGG + Intronic
1049933882 9:482142-482164 ATGTACCAGGCGAATACAAGGGG - Intronic
1050524152 9:6530845-6530867 ATGTTCCACTCTTACACATGTGG - Intergenic
1055972687 9:81927651-81927673 ATGTGCCCATGGAATACATGAGG + Intergenic
1055974440 9:81942723-81942745 ATGTGCCCATGGAATACATGAGG + Intergenic
1056980108 9:91302107-91302129 ACATGCCAGTCTGATATATGTGG + Intronic
1059647432 9:116281385-116281407 ATGTGGAAGTAAAATACATGAGG - Intronic
1198702042 X:139407314-139407336 ATATGTCAGTCTTATACATTTGG - Intergenic
1199264459 X:145814603-145814625 AGGTGCCAGTTTTACACATGGGG + Intergenic