ID: 915897345

View in Genome Browser
Species Human (GRCh38)
Location 1:159822555-159822577
Sequence CCTTCCATCCAGACTCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915897338_915897345 9 Left 915897338 1:159822523-159822545 CCTCAAAAGCAGACCAACCTAAA No data
Right 915897345 1:159822555-159822577 CCTTCCATCCAGACTCCTGCAGG No data
915897339_915897345 -4 Left 915897339 1:159822536-159822558 CCAACCTAAACCAAAGACCCCTT No data
Right 915897345 1:159822555-159822577 CCTTCCATCCAGACTCCTGCAGG No data
915897340_915897345 -8 Left 915897340 1:159822540-159822562 CCTAAACCAAAGACCCCTTCCAT No data
Right 915897345 1:159822555-159822577 CCTTCCATCCAGACTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915897345 Original CRISPR CCTTCCATCCAGACTCCTGC AGG Intergenic
No off target data available for this crispr