ID: 915897557

View in Genome Browser
Species Human (GRCh38)
Location 1:159823635-159823657
Sequence GTGCACAGGAGTAAATTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915897557_915897565 6 Left 915897557 1:159823635-159823657 CCAGCTAATTTACTCCTGTGCAC No data
Right 915897565 1:159823664-159823686 CTGTGGCTGGGTAATTAATATGG No data
915897557_915897560 -7 Left 915897557 1:159823635-159823657 CCAGCTAATTTACTCCTGTGCAC No data
Right 915897560 1:159823651-159823673 TGTGCACTCCCCTCTGTGGCTGG No data
915897557_915897561 -6 Left 915897557 1:159823635-159823657 CCAGCTAATTTACTCCTGTGCAC No data
Right 915897561 1:159823652-159823674 GTGCACTCCCCTCTGTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915897557 Original CRISPR GTGCACAGGAGTAAATTAGC TGG (reversed) Intergenic
No off target data available for this crispr