ID: 915897560

View in Genome Browser
Species Human (GRCh38)
Location 1:159823651-159823673
Sequence TGTGCACTCCCCTCTGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915897555_915897560 6 Left 915897555 1:159823622-159823644 CCCTTTGAACTCACCAGCTAATT No data
Right 915897560 1:159823651-159823673 TGTGCACTCCCCTCTGTGGCTGG No data
915897554_915897560 7 Left 915897554 1:159823621-159823643 CCCCTTTGAACTCACCAGCTAAT No data
Right 915897560 1:159823651-159823673 TGTGCACTCCCCTCTGTGGCTGG No data
915897557_915897560 -7 Left 915897557 1:159823635-159823657 CCAGCTAATTTACTCCTGTGCAC No data
Right 915897560 1:159823651-159823673 TGTGCACTCCCCTCTGTGGCTGG No data
915897556_915897560 5 Left 915897556 1:159823623-159823645 CCTTTGAACTCACCAGCTAATTT No data
Right 915897560 1:159823651-159823673 TGTGCACTCCCCTCTGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915897560 Original CRISPR TGTGCACTCCCCTCTGTGGC TGG Intergenic
No off target data available for this crispr