ID: 915897561

View in Genome Browser
Species Human (GRCh38)
Location 1:159823652-159823674
Sequence GTGCACTCCCCTCTGTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915897556_915897561 6 Left 915897556 1:159823623-159823645 CCTTTGAACTCACCAGCTAATTT No data
Right 915897561 1:159823652-159823674 GTGCACTCCCCTCTGTGGCTGGG No data
915897554_915897561 8 Left 915897554 1:159823621-159823643 CCCCTTTGAACTCACCAGCTAAT No data
Right 915897561 1:159823652-159823674 GTGCACTCCCCTCTGTGGCTGGG No data
915897557_915897561 -6 Left 915897557 1:159823635-159823657 CCAGCTAATTTACTCCTGTGCAC No data
Right 915897561 1:159823652-159823674 GTGCACTCCCCTCTGTGGCTGGG No data
915897555_915897561 7 Left 915897555 1:159823622-159823644 CCCTTTGAACTCACCAGCTAATT No data
Right 915897561 1:159823652-159823674 GTGCACTCCCCTCTGTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915897561 Original CRISPR GTGCACTCCCCTCTGTGGCT GGG Intergenic
No off target data available for this crispr