ID: 915898548

View in Genome Browser
Species Human (GRCh38)
Location 1:159829787-159829809
Sequence GCATGCATCTGAGCTGCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 98}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915898548_915898556 18 Left 915898548 1:159829787-159829809 CCTATAGCAGCTCAGATGCATGC 0: 1
1: 0
2: 1
3: 3
4: 98
Right 915898556 1:159829828-159829850 TGGGGCAGGCAGAGTGACCAGGG 0: 1
1: 0
2: 1
3: 46
4: 433
915898548_915898555 17 Left 915898548 1:159829787-159829809 CCTATAGCAGCTCAGATGCATGC 0: 1
1: 0
2: 1
3: 3
4: 98
Right 915898555 1:159829827-159829849 GTGGGGCAGGCAGAGTGACCAGG 0: 1
1: 0
2: 4
3: 41
4: 414
915898548_915898550 -9 Left 915898548 1:159829787-159829809 CCTATAGCAGCTCAGATGCATGC 0: 1
1: 0
2: 1
3: 3
4: 98
Right 915898550 1:159829801-159829823 GATGCATGCAAAGAAGGATGAGG 0: 1
1: 0
2: 1
3: 34
4: 300
915898548_915898554 4 Left 915898548 1:159829787-159829809 CCTATAGCAGCTCAGATGCATGC 0: 1
1: 0
2: 1
3: 3
4: 98
Right 915898554 1:159829814-159829836 AAGGATGAGGAGTGTGGGGCAGG 0: 1
1: 0
2: 2
3: 59
4: 678
915898548_915898551 -2 Left 915898548 1:159829787-159829809 CCTATAGCAGCTCAGATGCATGC 0: 1
1: 0
2: 1
3: 3
4: 98
Right 915898551 1:159829808-159829830 GCAAAGAAGGATGAGGAGTGTGG 0: 1
1: 0
2: 4
3: 55
4: 644
915898548_915898557 19 Left 915898548 1:159829787-159829809 CCTATAGCAGCTCAGATGCATGC 0: 1
1: 0
2: 1
3: 3
4: 98
Right 915898557 1:159829829-159829851 GGGGCAGGCAGAGTGACCAGGGG 0: 1
1: 0
2: 5
3: 41
4: 479
915898548_915898553 0 Left 915898548 1:159829787-159829809 CCTATAGCAGCTCAGATGCATGC 0: 1
1: 0
2: 1
3: 3
4: 98
Right 915898553 1:159829810-159829832 AAAGAAGGATGAGGAGTGTGGGG 0: 1
1: 0
2: 4
3: 58
4: 824
915898548_915898552 -1 Left 915898548 1:159829787-159829809 CCTATAGCAGCTCAGATGCATGC 0: 1
1: 0
2: 1
3: 3
4: 98
Right 915898552 1:159829809-159829831 CAAAGAAGGATGAGGAGTGTGGG 0: 1
1: 0
2: 2
3: 36
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915898548 Original CRISPR GCATGCATCTGAGCTGCTAT AGG (reversed) Intronic
900551021 1:3255618-3255640 GCATTCAACTTAGCTGCTGTGGG + Intronic
901066239 1:6496061-6496083 GCATGGGTCTGAGATGCTTTGGG - Intronic
901919216 1:12524467-12524489 GCATGATTCTGAGCTCCTCTAGG - Intergenic
902252280 1:15161956-15161978 TGATGCATCTGAGATGCCATGGG - Intronic
902770282 1:18641821-18641843 GCAGCCATCTGCGCTGCTCTCGG + Intronic
909283253 1:73784571-73784593 TGATGAATTTGAGCTGCTATAGG - Intergenic
911586070 1:99692377-99692399 CCATGCATCTAAAATGCTATGGG + Intronic
913203326 1:116513679-116513701 GCCTGCATCTGAGCTCCCACAGG - Intergenic
915898548 1:159829787-159829809 GCATGCATCTGAGCTGCTATAGG - Intronic
918272839 1:182919959-182919981 GCATGCATGTGTGCTGGTAGGGG - Intronic
922551563 1:226498015-226498037 GCATGCATCGGTGCTGCAAGGGG + Intergenic
1064485552 10:15784904-15784926 GAGGGCGTCTGAGCTGCTATAGG + Intronic
1065888185 10:30097426-30097448 GGATGCATCTGATATGCTGTAGG - Intronic
1067941192 10:50658771-50658793 CCATGCCCGTGAGCTGCTATGGG - Intergenic
1074868892 10:117561761-117561783 GGGTGCAACTGAGCTGCCATGGG - Intergenic
1075986984 10:126796794-126796816 GCATGGATCTGAGATGTTCTTGG - Intergenic
1078584053 11:12565324-12565346 GCATACCTCAGAGATGCTATGGG + Intergenic
1080848386 11:36046238-36046260 GCATGCAACAGAGCTGGTACAGG - Intronic
1086406095 11:86500086-86500108 GCCTGCATCTGACCTCCTCTTGG + Intronic
1089003138 11:115068678-115068700 GCATCCATCAGAGATGCTCTGGG - Intergenic
1096961284 12:55580444-55580466 GCATCACTCTGAGCAGCTATAGG + Intergenic
1097181766 12:57175742-57175764 GCAGGCCTCTGAGCTGCAGTGGG + Intronic
1097884911 12:64719390-64719412 CCATGCATTTGAGCTGCTGGTGG - Intronic
1098573592 12:72015725-72015747 GCAAGCATCTGTGCTGTTAGGGG - Intronic
1101201804 12:102444147-102444169 GCAGGCATTGGTGCTGCTATTGG + Intronic
1101844488 12:108351604-108351626 GAATGCATCTGAGCAGATATAGG - Intergenic
1110131960 13:72020900-72020922 GAATGCATCTATCCTGCTATTGG - Intergenic
1111370898 13:87314830-87314852 GCAAGCAGCTGAGCTGGTAATGG - Intergenic
1118070190 14:62238280-62238302 GGCAGCATCTGAGCTGCTAGAGG - Intergenic
1121735495 14:96214927-96214949 GAATGCATCAGAGCTGCCAGGGG + Intronic
1125033491 15:35096603-35096625 GACTGCATCTGAGCTGCAAGCGG - Intergenic
1130820757 15:87492881-87492903 AAAAGCATCTGAGCTGGTATTGG - Intergenic
1135338244 16:21622684-21622706 GAATGCACTTGAGCTTCTATAGG + Intronic
1140307163 16:73813837-73813859 GCCTGCAGCTGAGCTGCCAAGGG - Intergenic
1142868062 17:2803016-2803038 GCATGAAGCAGAGCTGCTAAGGG + Intronic
1148425965 17:47596391-47596413 GTATTCATCACAGCTGCTATAGG - Exonic
1149080007 17:52643901-52643923 CCTTGGATCTGAGCTGCTTTGGG - Intergenic
1150290230 17:63976970-63976992 GCATGCTTCTGAGAGGCTCTGGG - Intergenic
1151233177 17:72699482-72699504 CCCTCCATCTGAGCTGCTGTAGG - Intronic
1151807629 17:76416428-76416450 GCATCCCTCTGAGCTGCTTCTGG + Intronic
1160620677 18:80168233-80168255 GCATGCAGCTGCGGTGGTATGGG + Intronic
1163622167 19:18367563-18367585 GCATGCAACTGACCTTCTTTGGG - Exonic
1166229958 19:41420939-41420961 TCATGCATCTCAGCTGCCCTAGG - Intronic
924980036 2:211046-211068 GAATCCATCTGAGCTGCCAGTGG + Intergenic
925090095 2:1148386-1148408 GCATGCACCTGGGCTGCCCTGGG - Intronic
925217886 2:2112829-2112851 GCATGGTTCAGAGCTGATATTGG - Intronic
925350774 2:3199631-3199653 GTCTGCATCTGAGCAGCTATGGG + Intronic
928421487 2:31140278-31140300 GCAAGCTGCTGAGCTGCTGTTGG + Intronic
931887730 2:66635147-66635169 ACATGTATCTGATCTGCAATTGG + Intergenic
932449969 2:71803204-71803226 GCATGCTTCTGAGATGCTCTTGG - Intergenic
935502649 2:103859751-103859773 GCATTCATCTGATCTATTATTGG + Intergenic
938243214 2:129758910-129758932 GCAGGCAGCTGGGCTGCTGTGGG - Intergenic
939138331 2:138323405-138323427 CCCTGCATATGAGCTGCTAAAGG - Intergenic
945325380 2:208476178-208476200 ACATGCTTCTCAGCTGCTCTTGG + Intronic
1172098282 20:32471235-32471257 GCATGCCTCTGAGCCTCTACCGG - Intronic
1172098294 20:32471286-32471308 GCATGCCTCTGAGCCTCTACCGG - Intronic
1172098313 20:32471388-32471410 GCTTGCCTCTGAGCTTCTACCGG - Intronic
1174121922 20:48272230-48272252 GCATGCCCCTGGGCTGCTCTTGG + Intergenic
1175402259 20:58707373-58707395 GCCTTCATCAGAGCTGCTCTGGG + Intronic
1176695461 21:9972151-9972173 GCATGCAGGTGAGCAGGTATAGG + Intergenic
1183053440 22:35284972-35284994 GATTGCTTCTGAGCTGCTCTAGG + Intronic
949922040 3:9010482-9010504 GCCTGCATCTGAGCTGCGGGAGG - Intronic
951630256 3:24712262-24712284 GCAAGGAACTGAGCTACTATGGG + Intergenic
952348634 3:32512511-32512533 GCATGCAGCAGAAATGCTATAGG - Intergenic
954790953 3:53133067-53133089 GCATCCATGTAAGCTGCTTTGGG + Intergenic
960949936 3:122992784-122992806 GCCCGCAGCTGAGCTGCTACGGG - Intronic
961571396 3:127801660-127801682 GCATGCATCTGAACTTTTCTTGG - Intronic
962941202 3:140126155-140126177 GCAAGGAACTGAGATGCTATGGG + Intronic
963794539 3:149618384-149618406 GCATCCATCTGTGCTGGTCTTGG + Intronic
964461812 3:156940247-156940269 GCATACATGTGACCTACTATTGG - Intronic
972305945 4:37830060-37830082 GCTGGCCTCCGAGCTGCTATGGG + Exonic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
982448445 4:155522882-155522904 GCATGGATTTGAGGAGCTATGGG + Intergenic
983458683 4:167998862-167998884 GCATGTATGTGAGCTCCTGTTGG - Intergenic
986186387 5:5445059-5445081 GCGGGCATCTTACCTGCTATGGG + Intronic
992416042 5:76552164-76552186 GCAGGCTTCTGAGATGCTACAGG - Intronic
996548937 5:124710068-124710090 GCATGTATCTTAGTTGATATTGG + Intronic
998296954 5:140980212-140980234 GCCTGCATCTGAGCTGTTGGTGG + Intronic
998407261 5:141881060-141881082 GACTGTAGCTGAGCTGCTATTGG + Intergenic
1002467355 5:179414210-179414232 GCAGGAATGTGAGCTGCTGTGGG + Intergenic
1002864471 6:1108646-1108668 GCATGTATTTGAGCTGCGCTTGG - Intergenic
1002933686 6:1653073-1653095 GCATGCATCTGTGCTCCTCAAGG - Intronic
1005862646 6:29913316-29913338 GGATGCAGCTGAGCTGCTATGGG + Intergenic
1015066564 6:129036661-129036683 GGAGGCTTCTGAGCTGCTGTGGG - Intronic
1015412761 6:132913427-132913449 TCATGAGTCTGAGCTGCTTTGGG - Intergenic
1021834283 7:24652671-24652693 GCATCCTACTGAGATGCTATAGG + Intronic
1026810432 7:73459442-73459464 CTATGCATTTTAGCTGCTATAGG - Intronic
1027675388 7:81151218-81151240 GCCTGCATCTGAGCTACCAAGGG + Intergenic
1032473125 7:132192672-132192694 TCATGATTCTGAGCTGCTTTTGG - Intronic
1033663732 7:143422222-143422244 GCAGGCAGCAGAGCTGCTGTGGG + Intergenic
1034881678 7:154767577-154767599 ACAGGCCTCTGAGCTTCTATTGG + Intronic
1036999599 8:13702854-13702876 ACATGCAGCTGAGCTGTCATTGG + Intergenic
1037185906 8:16063383-16063405 TCTTGCATCTGGACTGCTATGGG + Intergenic
1049647556 8:143742430-143742452 GGAGGCATCTGAGCTGCAAAAGG + Intergenic
1053140701 9:35680902-35680924 GCATGCAAATGAGCTGCTCCTGG + Intronic
1061588961 9:131585791-131585813 GCCTGATGCTGAGCTGCTATGGG + Intronic
1188931343 X:36114862-36114884 GCATGCATATCAGCTGCATTAGG + Intronic
1189511089 X:41662187-41662209 GCAAGATTCTAAGCTGCTATGGG - Intronic
1189777206 X:44481197-44481219 CCATTCATCTGAACTGCTTTGGG + Intergenic
1192199997 X:69060669-69060691 GCATGCCTCTGGTCTGCTCTGGG + Intergenic
1193494727 X:82197189-82197211 GCATGCATTTGTGCTGGTAGTGG + Intergenic
1198655540 X:138909606-138909628 GCATGCATTAGCCCTGCTATTGG - Intronic
1201747207 Y:17390049-17390071 GAATGCATCTGTGCTTCTCTGGG - Intergenic