ID: 915900023

View in Genome Browser
Species Human (GRCh38)
Location 1:159840196-159840218
Sequence CTGGTTAGACAGAGTTTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915900023_915900027 12 Left 915900023 1:159840196-159840218 CCATTTAAACTCTGTCTAACCAG 0: 1
1: 0
2: 0
3: 7
4: 157
Right 915900027 1:159840231-159840253 GAGGTCGGAGCTCTGTCTGCTGG 0: 1
1: 0
2: 2
3: 23
4: 152
915900023_915900026 -3 Left 915900023 1:159840196-159840218 CCATTTAAACTCTGTCTAACCAG 0: 1
1: 0
2: 0
3: 7
4: 157
Right 915900026 1:159840216-159840238 CAGAGAGAAAATGAAGAGGTCGG 0: 1
1: 2
2: 7
3: 101
4: 956
915900023_915900024 -7 Left 915900023 1:159840196-159840218 CCATTTAAACTCTGTCTAACCAG 0: 1
1: 0
2: 0
3: 7
4: 157
Right 915900024 1:159840212-159840234 TAACCAGAGAGAAAATGAAGAGG 0: 1
1: 0
2: 2
3: 44
4: 552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915900023 Original CRISPR CTGGTTAGACAGAGTTTAAA TGG (reversed) Intronic
902644109 1:17786182-17786204 CTGTTCAGACAGAGTCTAACAGG + Intronic
902662964 1:17918228-17918250 TTGGCTAGCCAGAGTTTGAAGGG + Intergenic
910554788 1:88519434-88519456 CTGTTTACACAGAGTTCCAAGGG - Intergenic
912381196 1:109249178-109249200 TAGGTCAGACAGAGTTAAAAGGG - Intergenic
912757319 1:112335183-112335205 CTACTCTGACAGAGTTTAAATGG - Intergenic
914410452 1:147422283-147422305 CTGCTTAGAGAGAGATTAGATGG + Intergenic
914936950 1:151989852-151989874 CTGGTTAGACACATTTTGACAGG + Intronic
915686076 1:157636216-157636238 CTGGACAGACAGATTTTTAAAGG + Intergenic
915900023 1:159840196-159840218 CTGGTTAGACAGAGTTTAAATGG - Intronic
916799314 1:168200842-168200864 CTGGTTCGAAAAAGTCTAAAGGG + Exonic
1062767742 10:78705-78727 CTGCTGAGACAGAGTAGAAATGG + Intergenic
1063431326 10:5991259-5991281 CTGGTGAGTCTGATTTTAAAGGG + Intergenic
1064856974 10:19779844-19779866 CTGGGTATACAGTGTTTATAAGG + Intronic
1065812595 10:29455949-29455971 GTGGATAGACACAGTTTTAAAGG + Intergenic
1067916721 10:50407653-50407675 CTGGTTAGTCAGAGCTTAGCAGG - Intronic
1068330385 10:55557876-55557898 CTGGGTATACAGAGATTAAAGGG + Intronic
1069251180 10:66269122-66269144 ATGGTTCATCAGAGTTTAAAAGG - Intronic
1071341416 10:84652194-84652216 CTGGTTAGACAGTGGGTACAAGG - Intergenic
1071508591 10:86247444-86247466 GTGGGTAGAAAGAGTATAAAAGG + Intronic
1071852781 10:89592143-89592165 CAGTTCAGACGGAGTTTAAATGG - Intronic
1072789842 10:98309962-98309984 CTTGTTAGAAAGAGGTTCAAGGG - Intergenic
1073093517 10:100965802-100965824 CTGGCTAGAAAGAGACTAAATGG + Intergenic
1077968178 11:7158384-7158406 ATGGTGAGACAAAATTTAAAGGG - Intergenic
1080111533 11:28573518-28573540 CTGTTTAGACAGAGATGAAGAGG - Intergenic
1081624950 11:44648535-44648557 CGGGTTAAACAGAGGTTGAATGG - Intergenic
1081828674 11:46085772-46085794 CTGGTTTAACAGAGTTATAATGG + Intronic
1085484569 11:76851108-76851130 ATTGTTAGAAAGATTTTAAAAGG + Intergenic
1085560522 11:77468754-77468776 TTAGTTTGATAGAGTTTAAAAGG + Intronic
1087604081 11:100353918-100353940 CTGGCTAGACTGAGTGTAATGGG - Intronic
1088458270 11:110055538-110055560 CAGGTTAATAAGAGTTTAAAAGG + Intergenic
1088973325 11:114792357-114792379 CTAGTAAGACACAGATTAAAGGG - Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1092060503 12:5546787-5546809 CTGGTATGACAGAGACTAAATGG - Intronic
1093847975 12:23997787-23997809 CTAGGAAGACAGATTTTAAAAGG + Intergenic
1097528528 12:60769334-60769356 CTATATAGACAGAGTTTATATGG + Intergenic
1099721884 12:86373289-86373311 TTTGTTAAACAAAGTTTAAAGGG - Intronic
1111107167 13:83661867-83661889 AAGGTTATACAGAGTTGAAAAGG - Intergenic
1111570611 13:90079611-90079633 TTGGTTATTCAGTGTTTAAAAGG - Intergenic
1111637043 13:90919222-90919244 CTGATTATACAGAGGTCAAACGG - Intergenic
1112475840 13:99730269-99730291 CGTGTTAGTCAAAGTTTAAAAGG - Intronic
1115489663 14:33946897-33946919 GTGGTAAGAAACAGTTTAAATGG - Intronic
1117981740 14:61348492-61348514 CTGTTTAGACTGTGTTTAGATGG + Intronic
1119031521 14:71196541-71196563 GTGGTTTGAAAAAGTTTAAATGG - Intergenic
1120014222 14:79451780-79451802 CTGGTTTAAGAGAGATTAAAAGG + Intronic
1120353850 14:83402248-83402270 CTGGTAAAACAAAGTTTCAATGG + Intergenic
1124658027 15:31524461-31524483 CTTGTGAGGCAGAGTTTGAAAGG + Intronic
1126402646 15:48289051-48289073 GTAGTTTGAAAGAGTTTAAAGGG + Intronic
1126555334 15:49981245-49981267 GTGGTAAGACAAAGTTTAAAAGG - Exonic
1127062362 15:55199997-55200019 CAGGTTTGACAGAGTTGAAGAGG - Intergenic
1127157379 15:56142180-56142202 CTGGTTAGAAAAAGGTTAATAGG - Intronic
1127729155 15:61782484-61782506 CTGGTCAGACTGATTTTAATTGG - Intergenic
1130688505 15:86059938-86059960 CTGGTTAGAAGGAGTTGCAAGGG + Intergenic
1140986463 16:80162390-80162412 CTGCTGAGACAGAATTAAAAAGG - Intergenic
1149131078 17:53303084-53303106 TTGGTTAGAAAGAGTTTACTGGG - Intergenic
1153362658 18:4214773-4214795 CTGATTAGACTAAGTTCAAATGG - Intronic
1155728322 18:29118142-29118164 ATGTTTAAAAAGAGTTTAAAAGG + Intergenic
1156513437 18:37660625-37660647 TTGGATAGAGAGAGTTTAGATGG + Intergenic
1160222977 18:76990680-76990702 TTGCATAGACAAAGTTTAAAAGG - Intronic
1162972288 19:14187923-14187945 CTGGTTAGAGGGAGTAAAAATGG + Intronic
924979808 2:209389-209411 ATGTTTAATCAGAGTTTAAAAGG + Intergenic
926582127 2:14642270-14642292 TTAGCTATACAGAGTTTAAAAGG + Intronic
928229521 2:29485155-29485177 GTGCTTAGACATAGTCTAAAAGG - Intronic
928875779 2:36037313-36037335 ATGTTAAAACAGAGTTTAAATGG - Intergenic
928907948 2:36387996-36388018 CAGTTAAGACAGTGTTTAAAGGG - Intronic
930405068 2:50944060-50944082 TTGTTTAGACAGAATTAAAAAGG + Intronic
940210903 2:151255854-151255876 CTGGTTAGATACTTTTTAAAAGG + Intronic
940700643 2:157038118-157038140 CTGGTTAGACAGACTTCCCAAGG - Intergenic
943171037 2:184400539-184400561 CTGGTTTGACAGAGTTGACTGGG + Intergenic
945202782 2:207300330-207300352 CAGGCAAGACAGACTTTAAAAGG + Intergenic
945391670 2:209272853-209272875 CTGGTAAGTCAGAGATGAAAGGG - Intergenic
945485182 2:210387300-210387322 TTGCTCAGACAGACTTTAAATGG + Intergenic
946526048 2:220521550-220521572 TTGGCTAGACAGATTTTTAAAGG - Intergenic
1169667225 20:8050792-8050814 CTAGTTAGAGAGACTGTAAAGGG - Intergenic
1172731652 20:37094011-37094033 CTAGTTAGGCAGAGTTGAATAGG - Intronic
1177458082 21:21369836-21369858 CTGTGTTGAAAGAGTTTAAAGGG - Intronic
1177689639 21:24488703-24488725 CTGGTTAGTCAAAGTTTCAATGG - Intergenic
1178028436 21:28495500-28495522 CTGGTGAGTGAGAGTGTAAATGG - Intergenic
1178149405 21:29776918-29776940 CTCGGTAGACAGAGTTTATGAGG - Intronic
1180570246 22:16709578-16709600 CAGGTTAAACAGTGTTTAGAGGG + Intergenic
1181381736 22:22509868-22509890 CTGGTGAGACACAGTTAAACTGG - Intergenic
949741281 3:7237412-7237434 CTGGATACCCAGATTTTAAAGGG - Intronic
951186536 3:19720430-19720452 CAGCTTAGACAGATTTTCAAAGG + Intergenic
952323753 3:32301831-32301853 CTGGTTAGCCAGACTCGAAATGG - Intronic
953188760 3:40663810-40663832 CTGATTAGACAAAGTTAAAAGGG + Intergenic
953848117 3:46444933-46444955 CTGGGAAGCCAGAGTTTAAGAGG + Intronic
955013059 3:55038656-55038678 CTGGTTAAAAAGAGTTCAACAGG - Intronic
956665175 3:71635588-71635610 CTGGTTTTACATATTTTAAATGG - Intergenic
956955602 3:74335611-74335633 CTGGCTAGACTGAGTTAAAGAGG - Intronic
957571530 3:81952757-81952779 CAGGGCAGACAGATTTTAAATGG + Intergenic
963125583 3:141812829-141812851 CTGCTTAGACTGGGTTTTAAGGG + Intronic
963206548 3:142642123-142642145 CAGGTTAGACAGAGGTGACAAGG - Intronic
964621357 3:158722909-158722931 GTGTTTTGAGAGAGTTTAAAGGG - Intronic
966975548 3:185080296-185080318 CTGATTAGACACAATTTTAATGG - Exonic
970615003 4:17760749-17760771 CTGGTAAGCCAGAGTTTCCAAGG - Intronic
971348208 4:25831371-25831393 CTGGTTGGACAGGATTTAGATGG - Intronic
971655850 4:29343231-29343253 CTGATTTGACAGGGCTTAAATGG + Intergenic
973557188 4:52095754-52095776 TTGGTCAGACAGAGTTCAATAGG - Exonic
974734330 4:65910121-65910143 CTTGTGAGACACAGTTTATATGG + Intergenic
976857094 4:89617062-89617084 TTTGTGAGGCAGAGTTTAAAAGG + Intergenic
981848536 4:149199259-149199281 CTGATTAGAAAGAGTTTTATGGG - Intergenic
982470181 4:155779706-155779728 CTGATTACACAGAAATTAAATGG + Intronic
982832003 4:160074055-160074077 TTGGTTAGACTGAGGTTATATGG + Intergenic
982901832 4:161014789-161014811 CTGTGTATACATAGTTTAAAGGG - Intergenic
982906162 4:161075857-161075879 GTGTTTAGAGAGAGTTAAAAAGG - Intergenic
983513641 4:168634709-168634731 CTGGTTAGAGATGATTTAAAAGG + Intronic
983814751 4:172109667-172109689 CTGGATAGAAACAATTTAAATGG + Intronic
987931497 5:24405064-24405086 CTGGCTACAGAGAATTTAAAAGG - Intergenic
988040316 5:25880803-25880825 TTAGTTAAACAGAGTTAAAAAGG - Intergenic
988331799 5:29850804-29850826 CTAGTTATACAGAGTTCAAATGG + Intergenic
988484844 5:31660037-31660059 CTGGGTAGTCAGACTTTTAAAGG + Intronic
989553259 5:42760471-42760493 TTGGGGAGACAGACTTTAAATGG - Intronic
989590436 5:43107961-43107983 TGGGTCAGACAGAGTTAAAAGGG - Intronic
991316008 5:65307651-65307673 ATTGTTAGAGAGAATTTAAAGGG + Intronic
993513941 5:88806036-88806058 CAAGTTAAACAAAGTTTAAAAGG - Intronic
995450417 5:112293890-112293912 TTGGTTAAACAGTGTTTAATAGG - Intronic
999052018 5:148533107-148533129 CTAGGTAGACAGTGTTTAACAGG + Intronic
999629669 5:153557633-153557655 TTGGTTAGAAAATGTTTAAAGGG + Intronic
999704587 5:154260706-154260728 CATGTTAAACAGAATTTAAAGGG - Intronic
1000715574 5:164640034-164640056 CAGGATTGACACAGTTTAAATGG - Intergenic
1004118933 6:12800217-12800239 TTGGTTAGAATGAGTTTCAAAGG + Intronic
1004143328 6:13042064-13042086 AGGGTTCAACAGAGTTTAAAAGG + Intronic
1004368962 6:15035875-15035897 CTGGCAAAATAGAGTTTAAATGG - Intergenic
1005625651 6:27659750-27659772 CAGGTTAGATCGAGATTAAATGG - Intergenic
1005633458 6:27731159-27731181 CAGGTTAGGCTGAGGTTAAATGG + Intergenic
1011727444 6:90224925-90224947 CTGGTGAGTTAGAATTTAAAAGG + Intronic
1014651519 6:124044687-124044709 TCGCCTAGACAGAGTTTAAATGG + Intronic
1016843439 6:148546769-148546791 ATGACTAGACAGAGTTTTAATGG - Intronic
1017850349 6:158299837-158299859 CTGGTAAGACAAAGTGTAAGGGG + Intronic
1018303862 6:162432831-162432853 CTTGTTAAACAGATTTTGAATGG + Intronic
1018632428 6:165832776-165832798 TGGGTTTGACAGAGTTTAATTGG + Intronic
1019325338 7:435522-435544 CAGCTTAGACAGTGTTTAAAGGG - Intergenic
1020820848 7:12965282-12965304 TGGGTTAGATAGAGTTTAAGTGG + Intergenic
1021303561 7:19003306-19003328 GTGGGTAGACTGAGTTTCAATGG + Intergenic
1028216268 7:88137569-88137591 CTGGTTAGATAGAGAAAAAAGGG - Intronic
1028608453 7:92681468-92681490 CTGCTTAGACATAGATAAAATGG - Intronic
1031751098 7:125575160-125575182 CTGATTAGACAGAATATACAGGG - Intergenic
1031932157 7:127696483-127696505 CTGGTTAGAAAGAATGTAAGAGG + Intronic
1032215413 7:129953228-129953250 CTTGTTAAACAGAGTGTTAAGGG - Intergenic
1032866094 7:135925708-135925730 CTGGTTAAATACATTTTAAAGGG - Intergenic
1033846472 7:145439154-145439176 CTGGTGAAACACAGTATAAAAGG + Intergenic
1033948192 7:146748742-146748764 GTGGTCAAACAGAGATTAAATGG + Intronic
1036002297 8:4620975-4620997 TTGGCTAGAAAGATTTTAAAAGG + Intronic
1037992055 8:23328215-23328237 CTCCCTAGACAGAGTTGAAAGGG - Intronic
1038661796 8:29503957-29503979 TTGTTTTGCCAGAGTTTAAAGGG + Intergenic
1040291184 8:46125816-46125838 GTGGGCAGACAGAGTTAAAAGGG + Intergenic
1044275294 8:90292306-90292328 CTAGTGGGAAAGAGTTTAAAAGG - Intergenic
1044469382 8:92548561-92548583 CTTACTAGAAAGAGTTTAAAAGG - Intergenic
1044646684 8:94450867-94450889 CTGGTTAAACAGAAATTAATAGG + Intronic
1044923638 8:97190687-97190709 CTGATTTGACAGAGTTGCAATGG - Intergenic
1045398659 8:101787974-101787996 CTGGTTAGACAGGGGTTAAGAGG - Intronic
1049092798 8:140529411-140529433 CTGATGATTCAGAGTTTAAATGG - Intergenic
1055212307 9:73811535-73811557 ATGGTTAAATAGAGTTTGAATGG + Intergenic
1055868948 9:80850956-80850978 CTGGAGAGACAGAGGTTACATGG + Intergenic
1057924991 9:99138453-99138475 CTGGTCAGGAAGAGATTAAAAGG - Intronic
1060290686 9:122299864-122299886 GTGGTTAGACAGAGATTGATGGG + Intronic
1186961555 X:14742279-14742301 CTAGGTAGAGAAAGTTTAAAAGG + Intergenic
1192047544 X:67692037-67692059 TTGGTCAGACAGTGTATAAAAGG - Intronic
1192670031 X:73130291-73130313 TTGCATAGACAAAGTTTAAAAGG + Intergenic
1196993170 X:121350134-121350156 CTGGTTTGTCTGAGTTTCAAAGG + Intergenic
1197076034 X:122353803-122353825 CTGATAAGACAAAGTTTCAAAGG + Intergenic
1199436258 X:147815834-147815856 CTGATTAGAAAGAGTTCAAGGGG + Intergenic
1199448722 X:147956114-147956136 TTGGTTAAACAGATATTAAAGGG + Intergenic
1202247026 Y:22830446-22830468 CTGGTGAGACAGAATGTATAAGG + Intergenic
1202400015 Y:24464194-24464216 CTGGTGAGACAGAATGTATAAGG + Intergenic
1202470766 Y:25205892-25205914 CTGGTGAGACAGAATGTATAAGG - Intergenic