ID: 915902006

View in Genome Browser
Species Human (GRCh38)
Location 1:159854416-159854438
Sequence CAGCCTAAGCAGAGGGCCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915902006_915902014 -5 Left 915902006 1:159854416-159854438 CCCGGGGCCCTCTGCTTAGGCTG 0: 1
1: 0
2: 1
3: 28
4: 209
Right 915902014 1:159854434-159854456 GGCTGGGGACACCAGGCCTCCGG 0: 1
1: 0
2: 2
3: 50
4: 389
915902006_915902017 11 Left 915902006 1:159854416-159854438 CCCGGGGCCCTCTGCTTAGGCTG 0: 1
1: 0
2: 1
3: 28
4: 209
Right 915902017 1:159854450-159854472 CCTCCGGCCTCAGCCGCTCTAGG 0: 1
1: 0
2: 2
3: 105
4: 992

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915902006 Original CRISPR CAGCCTAAGCAGAGGGCCCC GGG (reversed) Exonic
901259558 1:7861607-7861629 CAGCCTCCGCAGCAGGCCCCAGG + Intergenic
902185909 1:14725308-14725330 GAGCCTAAGGAGGGGGTCCCAGG - Intronic
902232491 1:15036611-15036633 CACCCTAAGGAGCGGACCCCAGG - Intronic
902363918 1:15958619-15958641 CAGCCTTATCCCAGGGCCCCTGG - Intronic
902622078 1:17656463-17656485 CCTCCTAGGGAGAGGGCCCCAGG - Intronic
902837645 1:19057540-19057562 CAGCCTGAGCAGAGGCCCTGGGG + Intergenic
902956057 1:19924729-19924751 CGGCCTAACCAGCGGGCTCCAGG + Intergenic
903238042 1:21963540-21963562 CAACCAGAGCAGAGGGTCCCTGG + Intergenic
903370999 1:22836127-22836149 CAGCCTCTCCAGAGGGGCCCCGG + Intronic
904556235 1:31366615-31366637 CTGCCTAACCACAGGGCCTCAGG - Intronic
904866012 1:33579491-33579513 CAGAGGAAGCTGAGGGCCCCTGG - Intronic
905049429 1:35037114-35037136 CAGCGTAAGCAGAAGCCCCAAGG - Intergenic
907479093 1:54731713-54731735 AAGCAAAAGCAGAGGGCTCCTGG - Intronic
907527505 1:55062637-55062659 CAGGCAAAGCAAAGGCCCCCAGG + Intronic
907805723 1:57817514-57817536 CAGCCTGAGCTGAGAGCCCCAGG - Intronic
910116273 1:83735806-83735828 CAGCCTAAGGAGAGGCCCACAGG - Intergenic
911275382 1:95853093-95853115 CAGCCTGAGGAGGGGGCTCCAGG - Intergenic
912496406 1:110094837-110094859 CAGCATCATCTGAGGGCCCCAGG - Intergenic
915902006 1:159854416-159854438 CAGCCTAAGCAGAGGGCCCCGGG - Exonic
917811233 1:178660229-178660251 CAGCCTAAGCAGAAATCCCAAGG + Intergenic
919360269 1:196584033-196584055 CAGCCTAACAAGAGGGTGCCAGG + Intronic
919657701 1:200213878-200213900 CAACCCAAGCAGTGAGCCCCTGG + Intergenic
921931932 1:220761960-220761982 CAGCCTAGGCAGAGGTACCAGGG + Intronic
922725453 1:227920939-227920961 CAGCCAACCCAGAGGACCCCCGG + Exonic
1066440262 10:35431721-35431743 CACCCTAAGCATCGGGTCCCAGG + Intronic
1071780119 10:88835118-88835140 AAGCCTAAGCAGAGAGCTCCTGG - Intronic
1072618468 10:97064717-97064739 CAGCCTAGGCAGCGGGCATCAGG - Intronic
1073392764 10:103193073-103193095 CGGCCTAAGGAGAGGGGCCTTGG + Intronic
1074766133 10:116701237-116701259 CAGCTGAAGCAGAGTGCCTCTGG - Intronic
1074776514 10:116771545-116771567 GGGCCTAGACAGAGGGCCCCCGG + Intergenic
1075020526 10:118948823-118948845 CAGCCAAAGAACAGGGCCCAGGG + Intergenic
1075682483 10:124342581-124342603 CAGCAGAAGCAGATGGCCTCAGG + Intergenic
1076739932 10:132478089-132478111 CAGGCTGAGGAGAGGGGCCCTGG + Intergenic
1076895882 10:133311718-133311740 CAGCCTCAGCAGAAGCCCCAGGG + Exonic
1077093774 11:790883-790905 CAGCCTCTGCATAAGGCCCCTGG - Exonic
1077514785 11:2994965-2994987 CAGCCAGAGCTGAGGGCCACTGG + Intergenic
1077837715 11:5938778-5938800 CAGCCTACGCCGCGGGGCCCTGG + Intergenic
1078668451 11:13344858-13344880 CAGCCATGGCAGATGGCCCCTGG - Intronic
1080675185 11:34419621-34419643 CAGCCTATTCACAGGGCCCTAGG + Intergenic
1081654983 11:44851194-44851216 CAGCCTGAGCAGTGGGCCAGCGG + Intronic
1081677589 11:44979961-44979983 CAGCCTGAGCACAGGGCCCTGGG + Intergenic
1084001025 11:66295506-66295528 CAGCCTGAGCGGGGGGCCGCTGG + Exonic
1084029065 11:66470326-66470348 CACCCTAAGCAAAGGGCCCAAGG - Intronic
1084296521 11:68216008-68216030 CAGCCTCAGCTGAGAGGCCCAGG + Intergenic
1084312720 11:68326214-68326236 CTGACAAAGCAGAGGCCCCCAGG - Intronic
1086420355 11:86632227-86632249 CAGCCTGAGCAGAGGGCCTCTGG + Intronic
1087091410 11:94277234-94277256 CATCCCAAGCAGAGGGCCTCCGG - Intergenic
1087644292 11:100789375-100789397 CAGCCTAAGCTGAGGACCGAGGG + Intronic
1088720672 11:112589409-112589431 CTGTCTGAGCAGAGGGGCCCTGG + Intergenic
1088881669 11:113977792-113977814 CAGCCTCAGCAGAGCGGGCCTGG - Exonic
1089194750 11:116687708-116687730 CAGCCTAAACAGTGGTACCCTGG - Intergenic
1089703284 11:120258761-120258783 CACCCTGAGCAGACGGCACCAGG - Intronic
1089730979 11:120518579-120518601 CAGCATAAGCCCAGGGCTCCAGG + Intronic
1089777952 11:120852073-120852095 CAGCCTAAGGGGAGAGCCCGAGG + Intronic
1090703529 11:129316493-129316515 CACCCTAGGCAGAGGGGCCATGG - Intergenic
1090953619 11:131495762-131495784 GAGGCTCAGCAGAAGGCCCCAGG + Intronic
1092054812 12:5500039-5500061 CAGCCTAAACAGAAGGAGCCGGG + Intronic
1092566512 12:9671714-9671736 CAGCATAAAGAGAGGGCTCCAGG - Intronic
1097522775 12:60689392-60689414 GAGCCCCAGCAGAGGGACCCTGG + Intergenic
1101838760 12:108312974-108312996 CAGCCTAGGCAGGAGGACCCTGG - Intronic
1102100332 12:110273431-110273453 CAGCCTGAGGAGAGGTCCCAAGG + Intergenic
1102472661 12:113168265-113168287 CAGCCGAGGCAGAGGGGGCCCGG + Intronic
1103274579 12:119700954-119700976 CTGGCTCAGCAGAGGGCCTCTGG - Exonic
1103557734 12:121776170-121776192 CAGCAGAAGCAGAGTGGCCCCGG - Exonic
1107488128 13:40851346-40851368 CTACCTACGCAGAGGGCCCGAGG + Intergenic
1108290942 13:48960142-48960164 CAGCCTTAGAAGAGGGTACCTGG + Intergenic
1108343012 13:49516020-49516042 CATTCTAAGCAGAGGGCCTTGGG - Intronic
1114470184 14:22955749-22955771 CAGCCTAAGAAAAGAGCACCTGG + Intronic
1115041252 14:28931783-28931805 CAGCATAATCACAGGGGCCCTGG - Intergenic
1117340792 14:54789467-54789489 CAGCCATAGGAGAGGGCCCATGG + Exonic
1124583570 15:30984798-30984820 CAGCCTCAGCACAGGGGCCCAGG + Intronic
1125430796 15:39591359-39591381 CTGCCTGATCAGAGGGCCCGCGG + Intronic
1125469711 15:39990894-39990916 CAGCATAAGCAGAGGCCCCGGGG + Intronic
1130963777 15:88682216-88682238 CAGCCCATGCAGATGGCCCCTGG - Intergenic
1131069051 15:89452939-89452961 CAGCCTAGGCTGAGGGCCAGGGG + Intergenic
1131153081 15:90059216-90059238 CAGCCTGTGCAGAGGCCCCAAGG + Intronic
1132293001 15:100716123-100716145 CAGCCTGAGCAGAAGGCCAGCGG - Intergenic
1132638798 16:967538-967560 CGGCCTAAGCAGCGGGACCTGGG - Intronic
1134135470 16:11673950-11673972 CAGCTTCTGCAGAGGGCCCTGGG - Intronic
1134241240 16:12508656-12508678 CAGGCTTAACAGAGGGCACCAGG - Intronic
1134597994 16:15511139-15511161 AAGCATAACCAGATGGCCCCAGG + Intronic
1136272519 16:29156857-29156879 CTTCCTTAGCAGAGGGGCCCTGG + Intergenic
1138412451 16:56851083-56851105 CAGCACAAGCTGAGGGCCCCAGG - Intergenic
1138604947 16:58082617-58082639 CAGCCTGAGCAAAGGGCCTGAGG - Intergenic
1139388651 16:66591072-66591094 CATGCTAAGAAGAGGACCCCAGG + Intergenic
1142353720 16:89591354-89591376 CAGCCAGCGCAGAGGCCCCCAGG + Intronic
1147689257 17:42305546-42305568 TTGCCTAAGCAGAGGGCACGTGG + Intronic
1148174216 17:45550056-45550078 CTGAGGAAGCAGAGGGCCCCAGG + Intergenic
1148275046 17:46295391-46295413 CTGAGGAAGCAGAGGGCCCCAGG - Exonic
1148290134 17:46439102-46439124 CAGCCTCCCCAGTGGGCCCCAGG + Intergenic
1148297153 17:46512970-46512992 CTGAGGAAGCAGAGGGCCCCAGG - Exonic
1148312302 17:46656675-46656697 CAGCCTCCCCAGTGGGCCCCAGG + Intronic
1148361709 17:47017450-47017472 CTGAGGAAGCAGAGGGCCCCAGG - Intronic
1148668250 17:49390792-49390814 CAGCCCAAGCCAAGAGCCCCAGG + Intronic
1150223207 17:63508764-63508786 CAGCCTAGGCAGAGGCTCCGCGG + Intronic
1150405434 17:64896978-64897000 CTGAGGAAGCAGAGGGCCCCAGG + Exonic
1151385218 17:73751147-73751169 CAGCACAGGCAGAGGGCCCTGGG + Intergenic
1151552034 17:74827865-74827887 CAGCCTGAGCAGAGAACCACTGG - Intronic
1152828484 17:82482391-82482413 CAACGTAAGCAGATGGCCCCTGG - Intronic
1153280787 18:3412100-3412122 CAGCCTTCGCCGAGGGCCGCAGG + Intronic
1158846252 18:61445929-61445951 CAGCCTAGGCTGAGGGTCCCAGG + Intronic
1160818565 19:1047465-1047487 CAGCCGAAGCCGAAGGCCACGGG - Exonic
1161406421 19:4093925-4093947 CACCCTCAGAGGAGGGCCCCGGG - Intronic
1161700165 19:5790120-5790142 CAGACTCAGAAGAGGGCCCGGGG - Exonic
1163633282 19:18427618-18427640 CAGGGTGGGCAGAGGGCCCCAGG - Intronic
1163687099 19:18717850-18717872 CAGTACAAGCAGAGGGCCCCTGG + Intronic
1166117142 19:40663074-40663096 CAGTGGAAGCAGCGGGCCCCAGG + Intergenic
1167424533 19:49423298-49423320 CAGCCGAACCCGAGGGCTCCTGG + Exonic
1167506377 19:49873154-49873176 CAGCATAGGCACAGGGGCCCGGG + Exonic
1167526778 19:49989193-49989215 CAGACTAGGAAGAGGGCCCAGGG - Intronic
1168287538 19:55342113-55342135 CAGGCTAAGGAGAGGGCCGAGGG - Intronic
925923228 2:8652146-8652168 CTGCATATGCAGAGGGCCTCAGG + Intergenic
926937975 2:18105041-18105063 CAGGCTATGCACAGGGGCCCAGG - Intronic
928480062 2:31674708-31674730 CAGCCTCAACAGAGGGGCCAGGG + Intergenic
929821114 2:45274487-45274509 CAGCCTCAGCAGAGAGCCTCCGG - Intergenic
930121999 2:47768117-47768139 CAGCCCAAGCAGTGGGGACCCGG + Intronic
932655782 2:73610187-73610209 CAGCCTACACAGAGAGTCCCTGG - Intronic
933203676 2:79480082-79480104 CAGCATATGCAGAGGTCACCTGG + Intronic
933846977 2:86334716-86334738 CAGCCTGAGCAGATGGGCTCTGG - Intronic
933966847 2:87436983-87437005 CTGCCAAGGCAGGGGGCCCCAGG - Intergenic
933967567 2:87442471-87442493 CTGCCAAGGCAGGGGGCCCCAGG - Intergenic
935305108 2:101730054-101730076 CATCTTAAGGAGAGGGCCCCTGG - Intronic
936174207 2:110204870-110204892 CAGGCTGTGCAGAGGGCCCTGGG - Intronic
936326230 2:111508025-111508047 CTGCCAAGGCAGGGGGCCCCAGG + Intergenic
936326948 2:111513503-111513525 CTGCCAAGGCAGGGGGCCCCAGG + Intergenic
937271596 2:120656446-120656468 CTCCCTGAGCAGAGGGCCCTGGG - Intergenic
940341112 2:152582332-152582354 CAGCCTATGCAGAGGCTCACAGG - Intronic
944474265 2:200087764-200087786 AAGCCTTATCAGAGGGCACCAGG + Intergenic
945632543 2:212299691-212299713 CAGAATAAGCAGCAGGCCCCTGG + Intronic
947249817 2:228089732-228089754 CAGCCACATCAAAGGGCCCCAGG + Intronic
948159804 2:235814529-235814551 CAGCCGTAGCAGAGGACCCAGGG - Intronic
948564659 2:238876224-238876246 CAGCCTCTGCAGAGGGCACTAGG + Intronic
948987311 2:241533343-241533365 CCTCCTTAGCACAGGGCCCCAGG + Intergenic
1169192767 20:3668531-3668553 CAGTCGAACCATAGGGCCCCAGG + Exonic
1171186337 20:23126677-23126699 CAGCCTAAACCCAAGGCCCCAGG - Intergenic
1172657820 20:36547858-36547880 CAGCCACAGCAGTGGGCGCCCGG - Intronic
1175108711 20:56631111-56631133 CGGGCTACGCAGAGGGCCCCGGG - Intronic
1175305938 20:57975611-57975633 CAGGCTAAGCCCAGGCCCCCTGG + Intergenic
1175826117 20:61937577-61937599 CAGCCCCAGCAGAAGGCCCTGGG + Exonic
1175892169 20:62320763-62320785 CAGCCTGTGCAGACGGGCCCAGG + Exonic
1175987176 20:62769971-62769993 CAGCCCAGGCAGAGAGCCCTGGG - Intergenic
1176026356 20:62987570-62987592 CAGCTTTAGCAGGGGTCCCCGGG - Intergenic
1176448245 21:6840398-6840420 CAGCCTGAGCAGCGGGCACTTGG - Intergenic
1176826415 21:13705420-13705442 CAGCCTGAGCAGCGGGCACTTGG - Intergenic
1178351537 21:31875175-31875197 CAGGCTGGGCAGAGGCCCCCAGG - Intronic
1179157266 21:38861522-38861544 CAGCCGGAGAAGACGGCCCCAGG - Intergenic
1179610075 21:42544660-42544682 CAGCCTGAGCAGGGGCCTCCTGG + Intronic
1179801560 21:43813660-43813682 CAGCCTAGGGACAGGGCCACTGG - Intergenic
1180800775 22:18630925-18630947 CAAGCTAAGCAGAGGAGCCCTGG + Intergenic
1180852008 22:19026482-19026504 CAAGCTAAGCAGAGGAGCCCTGG + Intergenic
1181220942 22:21364337-21364359 CAAGCTAAGCAGAGGAGCCCTGG - Intergenic
1182268833 22:29140102-29140124 CAGGCTAAGCATGGGGCCCCAGG - Intronic
1183668058 22:39256463-39256485 CAGCCTCAGCAGAGGCCCCGGGG + Intergenic
1184550841 22:45203401-45203423 CAGGCTGAGGACAGGGCCCCAGG + Intronic
1184696577 22:46142813-46142835 AAGCATAAGCAGTGGGCACCTGG - Intergenic
1184827991 22:46966007-46966029 TACCCTCAGCACAGGGCCCCAGG - Intronic
950479679 3:13236702-13236724 CAGCCCTAGCACAGGGGCCCGGG - Intergenic
950550240 3:13661906-13661928 CATCCCAGGCAGAGGCCCCCAGG + Intergenic
950887852 3:16376383-16376405 CAGGCCAGGCAGAGGCCCCCAGG - Intronic
952956667 3:38562059-38562081 CAGCAGAAGCACAGGGGCCCTGG + Intronic
953492017 3:43360633-43360655 CAGCCTGAGGAGTGGGCTCCAGG - Intronic
956454670 3:69408843-69408865 CACTCTAAGCAGTGGTCCCCAGG - Intronic
959580340 3:107976866-107976888 CAGTTTGAGCAGAGGGCCCTTGG - Intergenic
961039008 3:123663895-123663917 CAGGCTCAGCAGAGGGGCCAAGG - Intronic
961353681 3:126320652-126320674 TAGCCTAAGAAGATGTCCCCTGG + Intergenic
961450772 3:127001392-127001414 CAGCCTGAGCTGATGGACCCTGG - Intronic
961819953 3:129570976-129570998 CAGCCTCAGCTGTGGGCCTCGGG - Intronic
962343974 3:134606500-134606522 CAGCCTCAGCTGAGGGGTCCGGG - Intronic
962980797 3:140487713-140487735 CAGCCTAAACAGAGGGACAAGGG - Intronic
964711289 3:159674400-159674422 CAGCCCATGCAGAGTGCCCAGGG + Intronic
964861543 3:161207891-161207913 CTGCCTCAGCAGAGTGACCCCGG - Intronic
965060048 3:163773518-163773540 CAGCTTAAGCACAGGGCACCAGG - Intergenic
966126253 3:176580362-176580384 CAGCCTATGCAAAGGGACCATGG - Intergenic
968492624 4:898361-898383 AGGCCTAGGCAGAGGGGCCCTGG + Intronic
968613604 4:1567769-1567791 CAGCCCCAGCCCAGGGCCCCCGG + Intergenic
968733626 4:2283937-2283959 GAGGCTAAGCAGAGGCCCACTGG + Intronic
969388779 4:6875123-6875145 CAGCCTCAGCAGAGGACACATGG + Intronic
972376141 4:38472409-38472431 CAGCCTAAACAGATCACCCCTGG - Intergenic
972794370 4:42400547-42400569 CAGTCTAAGCAAAGGGAGCCAGG - Intronic
975382554 4:73718235-73718257 CAGCCTAAGGAGAGGCCCATCGG - Intergenic
979770259 4:124515663-124515685 CTGTCTAAGTAAAGGGCCCCCGG - Intergenic
979778974 4:124625406-124625428 CAGCATAAGCAGAGGTCACATGG - Intergenic
981710906 4:147708113-147708135 ATGCCTAAGCAGAGGGCCCTGGG + Intergenic
981711094 4:147709676-147709698 CAGCCCAAGCAGCGGCCCACGGG + Intergenic
982072510 4:151707795-151707817 CAGCTGAAGCAGAGGGTCCATGG - Intronic
982857240 4:160399247-160399269 CTGCCTATGCAGGGGGCCCATGG - Intergenic
984250814 4:177332347-177332369 CAGCCCAAGCAAAGGTACCCTGG - Intronic
984664338 4:182409405-182409427 CAGCCAAAACAGAGGCCTCCTGG + Intronic
985043413 4:185915964-185915986 CAGCATAAGCAAAGGGCCCGTGG + Intronic
988165846 5:27589069-27589091 CAGCCTTACAAGAGGTCCCCTGG - Intergenic
992940099 5:81752025-81752047 CTGCCGCAGAAGAGGGCCCCAGG + Intergenic
994783671 5:104126904-104126926 AAACCCAAGCAGATGGCCCCTGG - Intergenic
997480489 5:134180710-134180732 ATGCCTAAGCAGGGGGCCCTGGG + Intronic
997984451 5:138491884-138491906 CAGCCTCCGGAGAGGGCCCGAGG + Intergenic
998952240 5:147404015-147404037 CAGCCTCAGCAGAGGGCATGAGG + Intronic
999230356 5:150058112-150058134 CAGCCTAAGCTGAGGCCCACTGG + Intronic
999291299 5:150428181-150428203 CAGCCAGAGCAGAGGTCCCATGG + Intergenic
1000352276 5:160361283-160361305 CAGTCTGGGCAGAGGGCCCTTGG - Intronic
1000556481 5:162732558-162732580 CAGATAAAGGAGAGGGCCCCTGG - Intergenic
1001596548 5:172902375-172902397 CAGGCTGGGTAGAGGGCCCCAGG + Intronic
1002462291 5:179380395-179380417 CTGCTTAGGCTGAGGGCCCCAGG - Intergenic
1003988317 6:11460338-11460360 CAGCATAAGCAGAGAGACACAGG + Intergenic
1007264241 6:40585367-40585389 CAGCATCAGCAGAAGGGCCCAGG + Intronic
1007513336 6:42391527-42391549 CAGTCTCAGCAGATGGCCTCAGG + Intronic
1012630753 6:101464252-101464274 CAGCCTAAGGAGAGGGTCCATGG + Intronic
1015602845 6:134927109-134927131 CAGGTTAAAGAGAGGGCCCCTGG + Intronic
1015908153 6:138138700-138138722 CAGCCTAAGCAGAGAGACAGGGG + Intergenic
1018057757 6:160067209-160067231 CAGCATGAGCAAAGGGCCCGAGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1019556774 7:1635662-1635684 CAGCCTATGGAGAGGGCCACAGG - Intergenic
1019689121 7:2400179-2400201 CAGACTTTGCAGAGGGGCCCAGG + Intergenic
1020730623 7:11874479-11874501 CAGCCTTAACAGAGTGTCCCTGG + Intergenic
1021817278 7:24460014-24460036 CAGCCTCTGGTGAGGGCCCCAGG + Intergenic
1024302602 7:47899209-47899231 CAGGCCAAGGAGAGTGCCCCAGG - Intronic
1029359181 7:100075824-100075846 CTGCCTGAGCAGATGGCCACAGG + Intronic
1032016440 7:128383115-128383137 AAGCCAAAGCAGAGGGTCCATGG + Intergenic
1032970382 7:137156311-137156333 CAGCCTAGGCAGAGGCCACAGGG - Intergenic
1033251172 7:139761166-139761188 CAGGGTAACCAGACGGCCCCAGG + Intronic
1035617128 8:1010902-1010924 CAGTCTACACAGTGGGCCCCAGG + Intergenic
1038207607 8:25482101-25482123 GAGTCTAAACACAGGGCCCCTGG - Intronic
1039550578 8:38440240-38440262 AAACCTCTGCAGAGGGCCCCCGG - Intronic
1040558938 8:48506513-48506535 CGCCCTGAGCTGAGGGCCCCGGG + Intergenic
1044934973 8:97285231-97285253 CAGCCTAAGGCGAGTGCCACAGG - Intergenic
1046624522 8:116562602-116562624 GCACCTAAGAAGAGGGCCCCTGG + Intergenic
1047732396 8:127737773-127737795 CAGCCGCAGCGGAGGGGCCCCGG + Intronic
1049578033 8:143398527-143398549 CAGCCCAAGCAGGAGTCCCCGGG - Intergenic
1049588014 8:143440850-143440872 GAGCTCAACCAGAGGGCCCCGGG + Intronic
1056847440 9:90053175-90053197 CAGCCTAAGCTGAGGACCACAGG - Intergenic
1058323132 9:103658813-103658835 CAGCCTAAGAACATGGCCACAGG + Intergenic
1058802403 9:108557554-108557576 CAGCCTTAGCAGAGGTGCCCTGG - Intergenic
1062290040 9:135790322-135790344 CAGCCTCAGCATGAGGCCCCTGG + Intronic
1203520946 Un_GL000213v1:44120-44142 CAGCCTGAGCAGCGGGCACTTGG + Intergenic
1190772611 X:53527599-53527621 TAGCCAAAACAAAGGGCCCCAGG - Intergenic
1192791603 X:74387473-74387495 TAGCCCAAGAAGAGGGCCCCAGG + Intergenic
1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG + Intergenic
1197626466 X:128807764-128807786 CAGCCTAAGCTGAGGTCCGAGGG - Intergenic
1200080786 X:153575422-153575444 CAGCCACAGCAAAGGTCCCCAGG + Intronic
1200448405 Y:3293736-3293758 CTGCCTTGGCTGAGGGCCCCGGG + Intergenic
1200835570 Y:7728102-7728124 CAGGCCAAGCAGAGGCCCCCAGG - Intergenic