ID: 915903456

View in Genome Browser
Species Human (GRCh38)
Location 1:159862333-159862355
Sequence ACCCTTGCCCTGCTGCAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 437}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915903456_915903460 -5 Left 915903456 1:159862333-159862355 CCCGGCTGCAGCAGGGCAAGGGT 0: 1
1: 0
2: 2
3: 40
4: 437
Right 915903460 1:159862351-159862373 AGGGTGGGCAGCACCCTGCCAGG 0: 1
1: 0
2: 7
3: 57
4: 1169
915903456_915903465 14 Left 915903456 1:159862333-159862355 CCCGGCTGCAGCAGGGCAAGGGT 0: 1
1: 0
2: 2
3: 40
4: 437
Right 915903465 1:159862370-159862392 CAGGCAACTCAGGCAGCCCCAGG 0: 1
1: 0
2: 0
3: 35
4: 295
915903456_915903461 4 Left 915903456 1:159862333-159862355 CCCGGCTGCAGCAGGGCAAGGGT 0: 1
1: 0
2: 2
3: 40
4: 437
Right 915903461 1:159862360-159862382 AGCACCCTGCCAGGCAACTCAGG 0: 1
1: 0
2: 1
3: 8
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915903456 Original CRISPR ACCCTTGCCCTGCTGCAGCC GGG (reversed) Intronic
900519299 1:3097980-3098002 ACACCTGCCCTGTTGCAGACAGG - Intronic
900623635 1:3598513-3598535 AGCCCGGCACTGCTGCAGCCTGG - Intronic
900659015 1:3773688-3773710 TCCCATCCCCTGCTGCACCCTGG + Intronic
900709101 1:4101233-4101255 CCCCCTCCCCTGCTGCTGCCTGG + Intergenic
900823318 1:4906953-4906975 AGTCTTGCTCTGCTGCAGGCTGG - Intergenic
900922248 1:5680521-5680543 ACACATGCCCTGTGGCAGCCTGG + Intergenic
900975514 1:6013793-6013815 ACCCACCCCCTGCTGCTGCCCGG + Intronic
901081814 1:6587989-6588011 CCCCTTGCTCTGCTACAGCTAGG - Intronic
901313928 1:8292707-8292729 GCCATTGCACTGCAGCAGCCTGG - Intergenic
901336500 1:8453763-8453785 ACCATTGCACTGGTCCAGCCTGG + Intronic
901404217 1:9035393-9035415 ATCCTTGGCCTTCTGCAGCAAGG - Exonic
901415044 1:9110846-9110868 TCCCTTCCCCTGGGGCAGCCCGG + Intronic
903383196 1:22910586-22910608 ACCCTGGCCCTGCCCCAGCCAGG + Intronic
904312798 1:29640210-29640232 ACCCGCTCCCTGCAGCAGCCTGG + Intergenic
904502678 1:30924931-30924953 ACCATTGCACTACTCCAGCCTGG - Intergenic
904545480 1:31267574-31267596 GCCGTTGCACTGCTCCAGCCCGG - Intronic
905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG + Intronic
906532324 1:46530883-46530905 ACTCTTCCTCTGCAGCAGCCAGG + Intergenic
906953949 1:50357299-50357321 ATCCTTGCTCTGCAGGAGCCTGG + Intergenic
908113803 1:60922218-60922240 ACAGGTGCCCTGCTGCAGGCAGG + Intronic
910072786 1:83239323-83239345 CCACATGTCCTGCTGCAGCCTGG + Intergenic
910138419 1:83999175-83999197 ACCATTCGCCTGCTGCGGCCGGG + Intergenic
910538668 1:88329591-88329613 ACCCTTGCCCTGCTTGAACTTGG - Intergenic
912761791 1:112374022-112374044 CCCCTTGCTGTGCTGAAGCCTGG - Intergenic
912796245 1:112695339-112695361 AGACTTGCCCTGCCCCAGCCTGG + Intronic
913047759 1:115088910-115088932 ACCCCTGCCCTGGGGCTGCCTGG - Intronic
914050286 1:144125537-144125559 ACCCCTGTCTTGCTGCACCCAGG - Intergenic
914128896 1:144839908-144839930 ACCCCTGTCTTGCTGCACCCAGG + Intergenic
915217953 1:154352473-154352495 ACCCTGGCTCTCCTGCACCCAGG + Intergenic
915268943 1:154738629-154738651 CCTCTTGACCTGCTCCAGCCCGG - Intronic
915903456 1:159862333-159862355 ACCCTTGCCCTGCTGCAGCCGGG - Intronic
915922137 1:159983955-159983977 TGCCTTTCCCTGCAGCAGCCAGG + Intergenic
916058020 1:161081330-161081352 ACCCTAGCACTACTGCACCCAGG - Intronic
917093743 1:171379902-171379924 ACTCTTTCTCTGCTGCAACCTGG + Intergenic
917724849 1:177818576-177818598 ACCATTGCCCTGGTGAAGCAGGG - Intergenic
918802273 1:188986832-188986854 ACTTTTCCCCTGCTGGAGCCAGG - Intergenic
919031830 1:192251997-192252019 GCTTTTCCCCTGCTGCAGCCAGG - Intergenic
919777715 1:201205166-201205188 GCCCCTGCCCTAGTGCAGCCTGG + Exonic
920116151 1:203623306-203623328 ACCCCAGCTCTGCTGCAGACAGG - Intergenic
920184900 1:204153335-204153357 ACCATTGCACTCCAGCAGCCTGG - Intergenic
920249744 1:204615638-204615660 CCCCTTTCCCTGCGGCACCCTGG - Intergenic
920377289 1:205516000-205516022 AACCTTGCCCTGCCCCAGCCTGG - Intronic
920388069 1:205581871-205581893 ACCCTTGCCCTGCTGCTCACTGG - Intronic
921636373 1:217499402-217499424 CCCCTTGCCCTTCTGCAGCGTGG - Intronic
922731399 1:227950340-227950362 GCCCTGGCCCAGCTCCAGCCAGG + Intergenic
922997196 1:229973448-229973470 ACCCATGTCCTCCTGCAGCGTGG - Intergenic
923102273 1:230826174-230826196 ACCCCTGCTCTGGTGCTGCCAGG + Intergenic
1063958361 10:11285397-11285419 AGCCTTTCCCTGCTGCCGCCTGG - Intronic
1064067543 10:12195640-12195662 ACGCGTGCCCAGCCGCAGCCTGG + Intronic
1064330076 10:14385391-14385413 CCCCTTGCCCTTCTGCATCAGGG - Intronic
1065735213 10:28745295-28745317 CCCCTTTCTCTGCTGCAACCTGG - Intergenic
1065788791 10:29241365-29241387 GCCCGTGCCCTGCTGCAAGCGGG - Intergenic
1066097517 10:32086246-32086268 ACACCTGCCCTCCTCCAGCCTGG + Intergenic
1067039321 10:42940628-42940650 ACCCAGGCCCTGGTGCATCCAGG + Intergenic
1067444377 10:46331516-46331538 CCTCCTGTCCTGCTGCAGCCTGG + Intergenic
1069300342 10:66899775-66899797 CCCCCTGCCAGGCTGCAGCCTGG - Intronic
1070665038 10:78336720-78336742 TTCCCTGCCCTGCTCCAGCCTGG - Intergenic
1070788698 10:79177056-79177078 GCCCAGGCCCTGCTGCAGCTGGG - Intronic
1071501720 10:86208705-86208727 ACCCTGGTCCTCCTGGAGCCTGG - Intronic
1071547498 10:86539588-86539610 ACCCTTCCTCCGCGGCAGCCAGG + Intergenic
1072196400 10:93120314-93120336 GCCCTTGTCCTTCTACAGCCAGG - Intergenic
1073297040 10:102446961-102446983 ACCATTGCACTCCAGCAGCCTGG + Intergenic
1074507475 10:114084481-114084503 ACCCTTGAGCTGTGGCAGCCAGG + Intergenic
1075793583 10:125103253-125103275 CCCCTGGCCCCACTGCAGCCTGG + Intronic
1075861934 10:125684428-125684450 TCCCTTGCACTGCTGCTGCTGGG - Intergenic
1076443000 10:130493064-130493086 TCCCTCTTCCTGCTGCAGCCTGG + Intergenic
1077036061 11:495053-495075 ACCCCCGCCCTGCTTCACCCAGG - Exonic
1077315467 11:1917613-1917635 ACCCATGCCCTGCTGCCATCTGG - Intergenic
1077891104 11:6418890-6418912 GCCCCTACCCTGCGGCAGCCCGG - Intronic
1078089165 11:8253255-8253277 AAGCTTGCCCTGCTCCAGACAGG - Intronic
1078607550 11:12790208-12790230 GCTCTGGCCCTGCTGCAGACAGG - Intronic
1080014420 11:27489672-27489694 CCCCTTCCCATGCTGCAGACAGG - Intergenic
1081340167 11:41917928-41917950 ACTTTTCCCCTGCTGAAGCCAGG - Intergenic
1083159000 11:60842938-60842960 GCCTTTGCCCTGCTGCAGCCTGG + Intronic
1083431522 11:62615824-62615846 AGCCAGGCCCAGCTGCAGCCAGG + Intronic
1083431865 11:62617387-62617409 ACCATTTGCCTGCTCCAGCCAGG + Intronic
1083924307 11:65796699-65796721 CCCCTTTCCCAGCTGCAGCAAGG - Exonic
1084088725 11:66866521-66866543 GCCCCTGCCCTGCTCCCGCCGGG + Intronic
1084089202 11:66869258-66869280 CACCTTGCCCTGCTGCCTCCTGG + Intronic
1084113829 11:67030448-67030470 ACCCTCATCCTGCTGCACCCTGG + Intronic
1084170544 11:67398903-67398925 CCCCTTCCCCTGCCGCAGGCCGG + Intronic
1084219896 11:67671403-67671425 ACCCCTGCCCTGCAGCAGGTGGG - Intronic
1084424280 11:69076286-69076308 AGCCTGGGCCTGCTGCACCCAGG - Intronic
1085449842 11:76625186-76625208 ACCCTTGACCAGCTCCTGCCTGG + Intergenic
1090052107 11:123388631-123388653 ACCATTGCCCTACTCCAGCCTGG + Intergenic
1090262230 11:125330054-125330076 ACCCCTGCACTGCTGCTTCCAGG - Intronic
1090972080 11:131652784-131652806 ATTCCTGCCCTGCTGCAGCGTGG - Intronic
1091375611 12:22957-22979 CCTCCTGCTCTGCTGCAGCCGGG - Intergenic
1091694471 12:2618520-2618542 ACCGGTGCCCTGGGGCAGCCAGG + Intronic
1092563555 12:9641715-9641737 ACCGTGGCCCTGCTGCACTCTGG + Intergenic
1092917716 12:13203343-13203365 TCCCTTGACCAGCTGCAGTCTGG + Intronic
1093989533 12:25574343-25574365 ACCCTTGCCCTCCCCCATCCAGG + Intronic
1095524605 12:43110091-43110113 GGCATTGCCCTTCTGCAGCCTGG + Intergenic
1095953787 12:47795458-47795480 CGCATTGCCCTGCTGCACCCTGG - Intronic
1096087767 12:48877555-48877577 ATCCTTGGCCTTCAGCAGCCTGG - Intergenic
1096503313 12:52078649-52078671 CCACTTGGCCTGCTGCAGTCTGG + Intergenic
1098508666 12:71285102-71285124 ACCTTGGCCCTGGTGCAGGCTGG + Intronic
1098914589 12:76244051-76244073 ACCTGTGCCCAGCTGCAGCCTGG + Intergenic
1099287047 12:80726165-80726187 CCCCTTACCCTGCAGTAGCCTGG - Intergenic
1100491094 12:95078794-95078816 AGCCTTCCCCTGGTTCAGCCTGG + Exonic
1100941074 12:99723302-99723324 ACTTTTCCCCTGCTGGAGCCAGG + Intronic
1101468314 12:104970674-104970696 ACCATTGCACTCCAGCAGCCTGG + Intergenic
1103921662 12:124402492-124402514 GCCCATGCCCCGCAGCAGCCAGG - Exonic
1103948167 12:124538448-124538470 CCCCTGGCTCTGCTCCAGCCAGG - Intronic
1104189038 12:126460033-126460055 ACCTTTGCCCTGTTGCTGCAGGG + Intergenic
1104391874 12:128397693-128397715 AACCTTGCACTCCTGCAGCGTGG + Intronic
1104736966 12:131140917-131140939 GGCCTTGGCCTGCAGCAGCCAGG - Exonic
1104857912 12:131910446-131910468 CTCCTTGCTCTGCTGCAGCGGGG + Intronic
1104860094 12:131919088-131919110 TACCCTCCCCTGCTGCAGCCCGG - Intronic
1106101026 13:26695242-26695264 ACCCTCTCCCTACTCCAGCCCGG - Intergenic
1106128808 13:26922496-26922518 GCCCTTCCCCTTCTCCAGCCTGG + Intergenic
1106412009 13:29517082-29517104 ACCCTGGCCCTCCTGATGCCTGG - Intronic
1106594137 13:31122672-31122694 CCCCTTGCCCTGCTCCAGGAGGG - Intergenic
1106622050 13:31379986-31380008 CCCCTTCCCCTACTGTAGCCAGG - Intergenic
1106632889 13:31495578-31495600 ACCCTTGTCGTGCTGTAGCGAGG + Intergenic
1107264985 13:38542773-38542795 ACCATTGCCAGCCTGCAGCCTGG - Intergenic
1107309533 13:39062189-39062211 ACCCTTGACCTACTGCATCAAGG - Intergenic
1107978648 13:45713906-45713928 GCCCTGGTCCTGCAGCAGCCCGG - Exonic
1107999162 13:45890580-45890602 ACCCTTGCCCTACCCCTGCCTGG - Intergenic
1108957770 13:56182686-56182708 ACTTTTCCCCTGCTGGAGCCAGG + Intergenic
1113019815 13:105872387-105872409 ACCCATGAGCTGCTGCAGCAAGG - Intergenic
1113438226 13:110308992-110309014 AGCCCTGCCCTGTGGCAGCCGGG + Intronic
1113565991 13:111320167-111320189 ACCCCTGCCCTGATCCAGCCTGG + Intronic
1113692254 13:112319230-112319252 ACCCTTACCTGGCTGCATCCAGG - Intergenic
1113812349 13:113150308-113150330 GTCCTTGCCCTGCTGCAATCCGG + Intergenic
1113841440 13:113363781-113363803 GCCCCCGCCCTGCAGCAGCCGGG + Exonic
1113909349 13:113834845-113834867 ACCCTCGGCCTGCTCCTGCCCGG + Intronic
1114062944 14:19037283-19037305 ACCCCCGCCCCGCTGCACCCTGG - Intergenic
1114099316 14:19362714-19362736 ACCCCCGCCCCGCTGCACCCTGG + Intergenic
1114487495 14:23071599-23071621 TCCCCTCCCCTGCTGCAGCAAGG - Intronic
1114612508 14:24052060-24052082 GCCCGGGCCCTGCTGAAGCCGGG + Exonic
1116862585 14:50006661-50006683 ACCATTGCACTCCAGCAGCCTGG - Exonic
1119411717 14:74435871-74435893 ACACTTGCTGTGCTGCAGCAAGG - Intergenic
1120006424 14:79363039-79363061 ACCATTGCACTACTCCAGCCTGG - Intronic
1120871278 14:89339487-89339509 ACGCTTGCCCTGGTGCAGACGGG - Intronic
1121733845 14:96204726-96204748 ACTCCTGCCCAGCTGGAGCCAGG - Intronic
1121788015 14:96677406-96677428 GCCATTGCCCTGATCCAGCCTGG - Intergenic
1122035625 14:98947234-98947256 CCCCTTTGCCTGCTGCATCCAGG - Intergenic
1122124941 14:99573814-99573836 GCCCCTGCCCTGCAGAAGCCTGG + Intronic
1122169467 14:99860092-99860114 ACCCTTGCCCTCCTTCACCTGGG + Intronic
1122208979 14:100162737-100162759 ACCCCACCCCTGCTGCTGCCTGG - Intergenic
1122437376 14:101709406-101709428 AGGCTTGCCCTGCTGCATCTGGG - Intergenic
1122546300 14:102524600-102524622 AGCCTCGCCCTGCGGCTGCCTGG + Intergenic
1122662903 14:103309826-103309848 GCCCTTACCCAGCTCCAGCCAGG + Intergenic
1122846627 14:104503813-104503835 ACCCATGTCCTCCTGCAGCCTGG + Intronic
1123420161 15:20124846-20124868 ACCCCTGTCATGCTGCACCCAGG - Intergenic
1123445701 15:20328686-20328708 ACCCCTGTCATGCTGCACCCAGG + Intergenic
1123493491 15:20800447-20800469 ACCCTCGCCCCCCTGCACCCTGG + Intergenic
1123529384 15:21131382-21131404 ACCCCTGTCATGCTGCACCCAGG - Intergenic
1123549999 15:21369549-21369571 ACCCTCGCCCCCCTGCACCCTGG + Intergenic
1123775018 15:23570638-23570660 ACCACTCCCCTGCTGCAGTCAGG + Intronic
1123950198 15:25264342-25264364 CCACTTGGCCTGCTGCACCCAGG + Intergenic
1124633318 15:31349584-31349606 GCCCTTGCACTCATGCAGCCAGG - Intronic
1125616100 15:41014927-41014949 ACCCTCGCCCTGCTACACCAGGG - Intronic
1126553012 15:49953554-49953576 ACTTTTCCCCTGCTGGAGCCAGG - Intronic
1127119596 15:55759561-55759583 TCCATCTCCCTGCTGCAGCCTGG + Intergenic
1128326538 15:66727491-66727513 GCCCTTTCCCTGCTTAAGCCTGG - Intronic
1128327913 15:66737154-66737176 ACCCTGGGCCTGCTGGAGGCAGG - Intronic
1129030909 15:72616959-72616981 GCCCTTGTCCAGCTGTAGCCCGG + Intergenic
1129164697 15:73769960-73769982 ACCCTGGACTTGCTGCATCCTGG + Intergenic
1129209475 15:74059267-74059289 GCCCTTGTCCAGCTGTAGCCCGG - Intergenic
1129326635 15:74803358-74803380 CCAGTTGCCCTGCTGCCGCCAGG + Intergenic
1129666360 15:77581791-77581813 TCCCTTGCCAAGCAGCAGCCTGG + Intergenic
1129707717 15:77804258-77804280 AGCCTTGCCCTGTTCCTGCCTGG - Intronic
1131456892 15:92588624-92588646 ACCCTAACCTTCCTGCAGCCTGG + Intergenic
1131524607 15:93143081-93143103 ACCCATCCCCTGCTGCCTCCAGG + Intergenic
1202958329 15_KI270727v1_random:96767-96789 ACCCTCGCCCCCCTGCACCCTGG + Intergenic
1132543504 16:522431-522453 GCCCCTGCCCTCCTGCATCCAGG - Exonic
1132606678 16:796556-796578 ACCCCAACCCTGCGGCAGCCAGG - Intronic
1132667818 16:1090058-1090080 ACCCTGGCCCTGCTAGAGACAGG - Exonic
1132745118 16:1433266-1433288 CCCCTGGGCCTGCTGCACCCTGG + Intergenic
1132892332 16:2210436-2210458 ACCCTTGCTCTGCTGGAGGCTGG + Intronic
1134019984 16:10914927-10914949 ACCCTTCTCCCGCCGCAGCCTGG - Intronic
1134227153 16:12399980-12400002 ACCCATGTCCTGCTGCAGGCTGG + Intronic
1135588825 16:23691066-23691088 ACCCTGGCTCAGCTGCGGCCAGG + Intronic
1136103867 16:28014939-28014961 GCCCCTGCCCTGCCCCAGCCAGG + Intronic
1136344429 16:29665714-29665736 ACCCTTGCCCTGTAGCTGCAAGG + Exonic
1136375179 16:29861172-29861194 AACCTGGCCCTGCTGTACCCTGG - Exonic
1136519657 16:30787265-30787287 ACCCTTTGCCTCCCGCAGCCTGG + Intergenic
1136529945 16:30861372-30861394 ACGCCTGAACTGCTGCAGCCAGG + Intronic
1136721043 16:32319922-32319944 ACCCCTGTCATGCTGCACCCAGG - Intergenic
1136839424 16:33526208-33526230 ACCCCTGTCATGCTGCACCCAGG - Intergenic
1136996005 16:35188411-35188433 CTCCTTGCCCTTCTTCAGCCAGG - Intergenic
1137448601 16:48549685-48549707 TCCCTTGCCCTGCACCAGGCTGG - Intronic
1138123750 16:54422131-54422153 ACCCCAGCCCTGCAGCAGGCAGG - Intergenic
1138198064 16:55068800-55068822 GCTCTTGCTCTGCTGCTGCCTGG - Intergenic
1138558855 16:57788245-57788267 ACCCTCGCCCTGCTTTAGACAGG + Intronic
1138590997 16:57999943-57999965 ACCCTGGCCCTCCTGCAGCAAGG + Intronic
1138686967 16:58734209-58734231 ACCATGGCCCTGCTGCACTCCGG - Exonic
1138817941 16:60223936-60223958 ACACTTCCACTGCTGCAGCCTGG - Intergenic
1140034009 16:71359295-71359317 CCCCTTACCCTGCTGGAGGCTGG + Intronic
1140301802 16:73765127-73765149 AGCCTTGCCCTCCTGCTTCCAGG + Intergenic
1140475953 16:75239388-75239410 ACCCTGGCCCTGGGGCTGCCTGG - Intronic
1140812074 16:78588089-78588111 ACCCTTGCCTTCCTGCTGGCGGG + Intronic
1141196573 16:81865618-81865640 TCCTTTGCCCTGCTGCTGTCTGG + Intronic
1141682480 16:85552766-85552788 CCCCTTCCCCTGCTGCAGTGGGG - Intergenic
1141891130 16:86927067-86927089 ACCCATGCCCGGCTCCAGGCTGG + Intergenic
1142251310 16:88993278-88993300 GCTCCTGCCCAGCTGCAGCCCGG - Intergenic
1203005389 16_KI270728v1_random:197848-197870 ACCCCTGTCATGCTGCACCCAGG + Intergenic
1203136939 16_KI270728v1_random:1733969-1733991 ACCCCTGTCATGCTGCACCCAGG + Intergenic
1203149588 16_KI270728v1_random:1826493-1826515 ACCCCTGTCATGCTGCACCCAGG - Intergenic
1142558721 17:797180-797202 TCCCTTGCGCAGCCGCAGCCTGG + Intergenic
1142666209 17:1465325-1465347 TTCCTTGCCCTGCTGGAGTCAGG + Exonic
1142742248 17:1937929-1937951 ACCCTGGCCTTGCTCCAGCCAGG - Intronic
1142797318 17:2318566-2318588 ACCATTGTCCTGCCTCAGCCTGG + Intronic
1143287111 17:5798399-5798421 ACTCTACCCCTGCAGCAGCCTGG - Intronic
1145937297 17:28722143-28722165 ACCATTCTCCTGCTTCAGCCTGG - Intronic
1146054306 17:29573615-29573637 AGCCTTCCCAGGCTGCAGCCAGG + Exonic
1147218085 17:38912453-38912475 ACCCTGGCCCAGCGGCACCCTGG - Intronic
1147324483 17:39663719-39663741 AAACTTGCCCCGCTGAAGCCTGG - Intergenic
1147539066 17:41341748-41341770 ACACTTGCTCAGCTGCGGCCTGG - Intergenic
1147754027 17:42756345-42756367 CCTCTTGCCCTGCTCCAGGCAGG + Intergenic
1148283093 17:46364086-46364108 ACTCTTTCTTTGCTGCAGCCAGG + Intergenic
1148305310 17:46582011-46582033 ACTCTTTCTTTGCTGCAGCCAGG + Intergenic
1151566455 17:74901170-74901192 AGCCCTGCCCTGCTGGAGCCAGG - Intergenic
1152375046 17:79914598-79914620 TCCGTTACCCTGCTGCAGGCTGG - Intergenic
1152801487 17:82332848-82332870 ACCCCCGCCCTGCTGGAGACAGG + Intronic
1154316747 18:13310309-13310331 ACCACTGCCCTCCTCCAGCCTGG + Intronic
1154451136 18:14475365-14475387 ACCCTCGCCCCGCTGCACCTTGG + Intergenic
1155847782 18:30731224-30731246 ACTTTTCCCCTGCTGGAGCCAGG + Intergenic
1156589437 18:38469228-38469250 ACTGTCCCCCTGCTGCAGCCCGG - Intergenic
1160969979 19:1763321-1763343 ACCATTGCACTCCGGCAGCCTGG + Intronic
1161221618 19:3120544-3120566 ACGGTGCCCCTGCTGCAGCCAGG - Intronic
1161400339 19:4064466-4064488 AGCCCAGCCCTGCTGCTGCCAGG - Intronic
1161481707 19:4513965-4513987 CCCCTTTCCCGGCTGCAGGCAGG + Intronic
1161778930 19:6279040-6279062 ATCCTGCCCCGGCTGCAGCCAGG - Intronic
1162028693 19:7908302-7908324 GCCCTTCCCCTGCTCCTGCCTGG + Intronic
1162296932 19:9819668-9819690 CGCCTGGTCCTGCTGCAGCCTGG - Intronic
1163417270 19:17194331-17194353 ACCCCTGCCCTGCGTCTGCCTGG - Intronic
1163597978 19:18231530-18231552 AGCCTGGCCCTCCAGCAGCCTGG - Intronic
1165648531 19:37466584-37466606 GCCATTGCCCTCCAGCAGCCTGG + Intronic
1165908533 19:39208935-39208957 ACCATTGCACTGCAGCAGCCTGG - Intergenic
1165932604 19:39369714-39369736 CACCTTCCCCTGCTTCAGCCAGG + Exonic
1166498016 19:43318985-43319007 ACACTTTCACTGTTGCAGCCTGG + Intergenic
1168170717 19:54586876-54586898 ACCCTTCCTCTGCTGTAGCAGGG - Intronic
1168415029 19:56162241-56162263 ACCACTGCCCTACTCCAGCCTGG + Intergenic
1202689693 1_KI270712v1_random:78175-78197 ACCCCTGTCTTGCTGCACCCAGG - Intergenic
925194157 2:1910056-1910078 ACCCTTGCCCTCACACAGCCTGG + Intronic
925451559 2:3973566-3973588 ACCCGTCACCTGCAGCAGCCAGG - Intergenic
926052142 2:9752082-9752104 ACTCTTGCCCTCCAGCAGACTGG + Intergenic
926671650 2:15582320-15582342 ACTGTTGGCCAGCTGCAGCCTGG - Intergenic
927151155 2:20196917-20196939 CCCCTCCCCCAGCTGCAGCCAGG - Intergenic
927213342 2:20651742-20651764 CCCGTTGCCCTGCTCCAGCTGGG - Intergenic
927351144 2:22117473-22117495 GCCATTGCACTACTGCAGCCTGG - Intergenic
927981708 2:27378611-27378633 CCCCTTTGCCTGCAGCAGCCTGG - Exonic
928757592 2:34545515-34545537 ACTTTTCCCCTGCTGGAGCCAGG - Intergenic
929370905 2:41222921-41222943 ACTTTTACCCTGCTGGAGCCAGG + Intergenic
929453965 2:42053651-42053673 ACACTGGCCCTCCTGCAGTCAGG - Intronic
929573093 2:43035129-43035151 ACGATTGCCCTGCTGCACGCCGG + Intergenic
930241578 2:48941098-48941120 GACCTTGCTCTGCTGCAACCTGG - Intergenic
931811159 2:65856388-65856410 AACCTTTCCCTGGGGCAGCCAGG - Intergenic
931877709 2:66531780-66531802 TCCTTGGCCCTGCTGCAGTCAGG - Intronic
932013454 2:68000750-68000772 ACTTTTCCCCTGCTGGAGCCAGG + Intergenic
932020897 2:68085375-68085397 ACCCTGACCCTGCTGCCTCCTGG + Intronic
932118562 2:69077204-69077226 ACCCTTGGCCTGCTCCAGAGAGG + Intronic
932419770 2:71594708-71594730 ACCCTTGCCATGCTTGCGCCTGG + Intronic
932826718 2:74948005-74948027 GCCTTTCCCCTGCTGGAGCCAGG + Intergenic
933900570 2:86846731-86846753 ACCCTTGGCCTGCTGGTGGCTGG - Exonic
933956727 2:87377847-87377869 ACCCCTGTCTTGCTGCACCCAGG + Intergenic
934090319 2:88545422-88545444 GCCCTTCCCCTCCTGCATCCTGG + Intergenic
934240871 2:90269874-90269896 ACCCCTGTCTTGCTGCACCCAGG + Intergenic
934272322 2:91546885-91546907 ACCCCTGTCTTGCTGCACCCAGG - Intergenic
934896933 2:98127434-98127456 CCTCCTGCTCTGCTGCAGCCCGG - Intronic
935173924 2:100631441-100631463 ACCACTGCCCTCCTCCAGCCTGG - Intergenic
935418628 2:102844208-102844230 GCACTGGCCCTGCTCCAGCCTGG - Intergenic
935779978 2:106502494-106502516 ACCCTTGGCCTGCTGGTGGCTGG + Intergenic
936148364 2:109996796-109996818 ACCCCTGTCATGCTGCACCCAGG - Intergenic
936196313 2:110374572-110374594 ACCCCTGTCATGCTGCACCCAGG + Intergenic
936493486 2:112996437-112996459 ACCATTGCACTCCTCCAGCCTGG - Intergenic
936849101 2:116874059-116874081 ACTTTTCCCCTGCTGGAGCCAGG - Intergenic
937341837 2:121096168-121096190 CCCATTGCCCTGCAGCACCCTGG - Intergenic
937931491 2:127208653-127208675 ACTTTTCCCCTGCTGGAGCCAGG + Intronic
938118129 2:128615881-128615903 CCCTTTGCTCTGCTGCACCCGGG + Intergenic
938480306 2:131657443-131657465 ACCCCCGCCCCGCTGCAACCTGG - Intergenic
938760030 2:134416510-134416532 ACCATTGCACTCCTCCAGCCTGG - Intronic
940273402 2:151915320-151915342 ACTTTTTCCCTGCTGGAGCCAGG - Intronic
940410715 2:153360517-153360539 ACTTTTCCCCTGCTGGAGCCAGG + Intergenic
940420908 2:153478469-153478491 AGCCGTGCGCTGCTGCACCCAGG - Exonic
941219971 2:162765798-162765820 ACCACTGCACTGCAGCAGCCCGG - Intronic
943676730 2:190722927-190722949 ACTCTTTCCCTCCTGCTGCCTGG + Intergenic
945037639 2:205717579-205717601 ACCTGTGCCCTGCAGCAGCCTGG - Intronic
946276447 2:218635366-218635388 AGTCTTGCTCTGCTGCAGGCTGG + Intronic
946692251 2:222318914-222318936 ACCCTCTCCCTGCTGCCCCCGGG - Intergenic
947637735 2:231688657-231688679 ACCCTTGGCCTGATGAAGCTGGG - Intergenic
948223406 2:236290849-236290871 ACCCTTCCCCTGCTTCTGCCGGG - Intergenic
948602884 2:239117279-239117301 AAGCATGCCCTGCTGCAGACAGG + Intronic
948696860 2:239737190-239737212 CCCCGTGCCCTGCTGCGACCTGG - Intergenic
948794957 2:240397752-240397774 ACCTTTGGCCTGCTGCCACCGGG + Intergenic
948909087 2:240994058-240994080 ACCCTGGCCCTGCTGGACCGTGG - Intergenic
948945160 2:241215629-241215651 ATCCGTGCCCTGCTCCTGCCAGG - Intronic
1171012254 20:21515099-21515121 ACCCTGGCCCTGCTGCCTCTGGG + Intergenic
1171334749 20:24373403-24373425 CCTCTTTCTCTGCTGCAGCCTGG - Intergenic
1173436998 20:43042467-43042489 TCTCTTTCCCTCCTGCAGCCGGG - Intronic
1173887452 20:46472795-46472817 ACCCTTGCCCCCGTGCAGTCAGG - Intergenic
1174302577 20:49593161-49593183 ACCCTTGCCCAGGTGCCCCCCGG + Intergenic
1174410297 20:50330759-50330781 TGCCTGGCCCTGCTCCAGCCAGG + Intergenic
1175259053 20:57663527-57663549 ACCCTTGTTCTGGTGGAGCCAGG - Intronic
1175749659 20:61486445-61486467 AGTCTTGTCCTCCTGCAGCCTGG - Intronic
1175818606 20:61896495-61896517 CCCCCTGCCCTGCTGCAGTGGGG - Intronic
1175865291 20:62172781-62172803 ACCGTAGCCCTGCTGCTGCCCGG - Exonic
1175913462 20:62415232-62415254 ACCATTGCCGTGGTGCGGCCTGG - Exonic
1177189727 21:17837550-17837572 ACTCTTACCCTGCTCCAGCATGG + Intergenic
1178601534 21:33999039-33999061 ACCCATCCCCAGCTGCGGCCAGG + Intergenic
1178795321 21:35738658-35738680 CCTCTTCCCCGGCTGCAGCCAGG - Intronic
1179211327 21:39327034-39327056 ACCCTAGGCCTGATGGAGCCAGG + Intergenic
1179543819 21:42101181-42101203 ACACCTGCCCTGCTGCCTCCCGG - Intronic
1180481437 22:15759910-15759932 ACCCCCGCCCCGCTGCACCCTGG - Intergenic
1180551728 22:16546388-16546410 ACCCCTGTCATGCTGCACCCAGG + Intergenic
1180895820 22:19331402-19331424 GCCCTGCCCTTGCTGCAGCCAGG + Exonic
1181352278 22:22267535-22267557 ACCCCTGTCATGCTGCACCCAGG - Intergenic
1182560056 22:31152675-31152697 ACCACTGCCCTCCTCCAGCCTGG + Intergenic
1182938949 22:34255287-34255309 ACTTTTCCCCTGCTGGAGCCAGG - Intergenic
1182962915 22:34493040-34493062 ATCCTTGCTCTGCTGCACTCAGG - Intergenic
1183305711 22:37082041-37082063 ACCCTTGCCCAACTGCATCAGGG + Intronic
1183508635 22:38222680-38222702 CCCCTTGCCCTGCTTTTGCCCGG - Intronic
1183662529 22:39230031-39230053 CCCCTTCCCCTGCAGCAGCTGGG - Intronic
1184424857 22:44403378-44403400 CCCCCTTCCCTGCAGCAGCCTGG - Intergenic
1184607230 22:45581147-45581169 AGCCCGCCCCTGCTGCAGCCAGG - Intronic
1184693429 22:46127631-46127653 ACCCTTGCCCCCATACAGCCTGG - Intergenic
1185043263 22:48516518-48516540 GCCTTTTCCCTGTTGCAGCCTGG + Intronic
1185172534 22:49302145-49302167 GCCCTTGCAGTGCTGCAGCCTGG - Intergenic
949267195 3:2172045-2172067 ACCACTGCTCTGCTGCATCCAGG + Intronic
950101251 3:10358333-10358355 CCTCTTGCCCTGCAGGAGCCAGG - Intronic
950136552 3:10585091-10585113 ACACCTGCCCTGCTGTAGCCTGG + Intronic
950649413 3:14397849-14397871 CCCATTGCCCTTCTGCAACCTGG - Intergenic
952357874 3:32601364-32601386 AGCCTTCCCAGGCTGCAGCCAGG - Intergenic
952503802 3:33989303-33989325 ACTTTTCCCCTGCTGGAGCCAGG - Intergenic
952930649 3:38358368-38358390 AGCCTTGCTCTGTTGCACCCAGG + Intronic
954063556 3:48088685-48088707 AGCCTTGCCCTGCGGCAGCTGGG - Intronic
954444614 3:50540065-50540087 ATCCCTGCCCTGCTGGAGCCTGG + Intergenic
954462183 3:50633648-50633670 AGCCTTGCCATCCTGCAGCCAGG + Intronic
955338179 3:58104159-58104181 TCTCTTTCCCTCCTGCAGCCCGG - Intronic
955967840 3:64407215-64407237 CGCCTTCCCCTGCTGCACCCAGG + Intronic
957717208 3:83943109-83943131 ACCACTGCACTACTGCAGCCTGG + Intergenic
959053708 3:101549051-101549073 ACGCTTTCTCTGCTGCAACCTGG - Intergenic
959380580 3:105636545-105636567 ACCCTTGCTCTGCTAAAACCTGG - Intergenic
961195261 3:124996123-124996145 ACCATTGCACCACTGCAGCCTGG - Intronic
966605158 3:181814229-181814251 ACCATTGCACTCCAGCAGCCTGG - Intergenic
966769648 3:183492422-183492444 ACCGTTTACGTGCTGCAGCCAGG + Intronic
966842084 3:184098118-184098140 ACCCTTGACCTGCTGCCTTCTGG - Intronic
966878036 3:184334814-184334836 ACCCTTGCCCTGCTGCTCAGCGG - Exonic
968359596 3:198137876-198137898 AGCCATGCCCTGCTGAAGCCTGG + Intergenic
968470474 4:779785-779807 GCTGTTGCCTTGCTGCAGCCTGG - Intergenic
968949479 4:3683231-3683253 ACCCTTGTCCTGCTGCAGTTCGG + Intergenic
968966003 4:3769417-3769439 ACCCCTGCCCAGCTCCTGCCAGG - Intergenic
969304665 4:6318762-6318784 ACCCTTGCCCTGCTCAAGAAAGG + Intergenic
969486354 4:7474503-7474525 GCCCATGCCCTCCTGCAGCCAGG - Intronic
969609644 4:8219725-8219747 ACGCTCTCCCTGCAGCAGCCCGG - Intronic
969971884 4:11056368-11056390 ACCCTCTCCCAGCTGCATCCAGG + Intergenic
970194442 4:13541458-13541480 ACCCCTGGCCTGGTGCTGCCTGG + Exonic
972249766 4:37287442-37287464 ACTTTTACCCTGCTGGAGCCAGG + Intronic
972498307 4:39654405-39654427 ACCATTGCACTCCAGCAGCCTGG - Intergenic
972788383 4:42347857-42347879 ACCATTGCACTCCAGCAGCCTGG - Intergenic
975848852 4:78551651-78551673 AGCCGCGCCCTGCTGCCGCCGGG - Exonic
978608042 4:110504094-110504116 TCCCTTCCCCTGCTGCCTCCAGG - Intronic
978656808 4:111074841-111074863 GCCTTTCCCCTGCTGGAGCCAGG + Intergenic
978773956 4:112486873-112486895 ACCCCTGCACTCCAGCAGCCTGG + Intergenic
980184637 4:129446389-129446411 ACTTTTCCCCTGCTGGAGCCAGG + Intergenic
980251624 4:130322813-130322835 ACCCTGACCCTGCTTCAGCTGGG + Intergenic
982997588 4:162369206-162369228 TCCCTTCCCCTGCTGGAACCAGG - Intergenic
984334994 4:178379253-178379275 ACTTTTCCCCTGCTGGAGCCAGG + Intergenic
986610182 5:9559189-9559211 ACCCTGGCCCTGGTGCACCATGG - Intergenic
987838014 5:23186531-23186553 CCCCCTGCCAGGCTGCAGCCTGG - Intergenic
987988589 5:25181285-25181307 GCTTTTGCCCTGCTGGAGCCAGG - Intergenic
988519293 5:31931507-31931529 ACTCCTGCCCAGCTGCAGCTGGG - Intronic
989605086 5:43236572-43236594 GCCCTTGCTCAGCTCCAGCCAGG - Intronic
990139099 5:52682530-52682552 ACTTTTTCCCTGCTGGAGCCAGG - Intergenic
990389730 5:55307171-55307193 ACAGTAGCCCTGTTGCAGCCTGG - Intronic
993071923 5:83175896-83175918 ACCATTGCCCGGCTGAGGCCAGG + Intronic
994344519 5:98668893-98668915 ACTTTTCCCCTGCTGGAGCCAGG + Intergenic
995600329 5:113789110-113789132 ACCCTTTCACTGAGGCAGCCTGG - Intergenic
996965926 5:129306867-129306889 TCTTTTCCCCTGCTGCAGCCAGG - Intergenic
997260841 5:132464549-132464571 CTCCATGCCCTGCTGCAGACAGG - Exonic
997533384 5:134596674-134596696 AACCTTGGCTTGCTGCATCCTGG - Intergenic
998788811 5:145743973-145743995 TGCTTTTCCCTGCTGCAGCCAGG + Intronic
999287848 5:150404877-150404899 ACCCGGGTCCAGCTGCAGCCTGG + Intronic
1000928248 5:167220067-167220089 ACCCTTGCACTGCGGAGGCCTGG - Intergenic
1001265650 5:170272651-170272673 ACCATTGCACTACTCCAGCCTGG - Intronic
1001721527 5:173860770-173860792 AGCCAGGCCCTGCTGCAGCCAGG + Intergenic
1001845107 5:174915497-174915519 GCCCTTGTCCAGCTGTAGCCCGG - Intergenic
1002326894 5:178415626-178415648 CCCCTTGCCCTCATGGAGCCAGG - Intronic
1002540453 5:179903030-179903052 ACCCTTCCCCTCCTGAAGCTGGG + Intronic
1003187452 6:3844668-3844690 ACCATTGCACTACTCCAGCCTGG + Intergenic
1003551755 6:7107483-7107505 ACCCTTCCCCTCGGGCAGCCCGG + Intergenic
1005826214 6:29632977-29632999 ACCCTGGCCAGGCTGGAGCCTGG - Exonic
1006514739 6:34539555-34539577 CTCCTTGCCCTGCAGCGGCCTGG - Exonic
1009871013 6:69452009-69452031 ACCATTGCCATGCTGCTGCAAGG + Intergenic
1010095096 6:72033520-72033542 ACCTTTGCACTACTCCAGCCTGG - Intronic
1010483227 6:76379313-76379335 ACTTTTCCCCTGCTGGAGCCAGG - Intergenic
1010995508 6:82527819-82527841 ACCACTGCACTGCTCCAGCCTGG - Intergenic
1011193539 6:84760855-84760877 ACCTTTACCATGCTGCAGACAGG - Intronic
1011736545 6:90316187-90316209 ACCCTTGTCCTGGTGCACTCGGG - Intergenic
1013461503 6:110378874-110378896 ACTTTTCCCCTGCTGGAGCCAGG + Intergenic
1014367596 6:120563439-120563461 ACTTTTCCCCTGCTGGAGCCAGG - Intergenic
1015917287 6:138230115-138230137 CCCCTTACCCTGCTCCACCCAGG + Intronic
1016590157 6:145735326-145735348 GCCCTGGCCCTGCAGGAGCCGGG - Exonic
1018595352 6:165474183-165474205 ACCCTAGGTCTTCTGCAGCCAGG + Intronic
1019260396 7:78775-78797 AGCCGTGCCCTGCTGAAGCCTGG - Intergenic
1019389868 7:780019-780041 ACCCTTGACACACTGCAGCCAGG - Exonic
1019505174 7:1386903-1386925 ACCCAGGCCCGTCTGCAGCCTGG - Intergenic
1019530747 7:1502029-1502051 AGGCTTGCACTGCAGCAGCCTGG + Intronic
1019597604 7:1865389-1865411 ATCCCAGCCCTGCTGCTGCCCGG + Intronic
1019718584 7:2554767-2554789 ACTCTGGCCCACCTGCAGCCTGG - Intronic
1021473037 7:21028384-21028406 AACCGCGCCATGCTGCAGCCAGG + Intergenic
1023297774 7:38734043-38734065 ACCACTGCCATGCTCCAGCCTGG + Intronic
1023849060 7:44140372-44140394 GCCCTTGCCCTCTTGCAGCATGG + Exonic
1024222526 7:47299668-47299690 CCCCTTGCACCCCTGCAGCCTGG - Intronic
1024632004 7:51256658-51256680 ACACTTGCCCTGCCTCTGCCTGG - Intronic
1026131817 7:67627230-67627252 AGGCTAGCTCTGCTGCAGCCTGG + Intergenic
1026907633 7:74071669-74071691 AATCTTGCCATGTTGCAGCCAGG + Intergenic
1026964616 7:74431249-74431271 GCCCTGGCCCTGGGGCAGCCCGG - Intergenic
1027290514 7:76704473-76704495 CCACATGTCCTGCTGCAGCCTGG + Intergenic
1028459162 7:91071813-91071835 GCTCTTCCCCTGCTGAAGCCAGG + Intronic
1029041443 7:97580374-97580396 ACTTTTCCCCTGCTGGAGCCAGG + Intergenic
1030304546 7:108004680-108004702 GCACTTGCCCTGCTACAGCCTGG + Intergenic
1030701583 7:112646941-112646963 ACTTTTCCCCTGCTGGAGCCAGG - Intergenic
1032246684 7:130219327-130219349 AACCTTTCTCTGCTGCAGCCTGG + Intergenic
1033879394 7:145862540-145862562 ACTTTTCCCCTGCTGGAGCCAGG + Intergenic
1034120063 7:148618997-148619019 ACTCTTGGCTTACTGCAGCCTGG - Intergenic
1034875390 7:154720596-154720618 ACCCCTGCCATGCTGCAGCCGGG - Intronic
1035760627 8:2066134-2066156 GCCCGTGCCCTGGTCCAGCCGGG + Intronic
1036289520 8:7475118-7475140 ACACCTGCCCTGCTCCTGCCTGG - Intergenic
1036331954 8:7836413-7836435 ACACCTGCCCTGCTCCTGCCTGG + Intergenic
1036599126 8:10242929-10242951 ACCCTTGCCCACCTGCATCCTGG + Intronic
1037876659 8:22551948-22551970 ATCCCTGCCCGGCTGCTGCCTGG - Exonic
1038406503 8:27326175-27326197 ACCCTTGCTTTCCTCCAGCCAGG - Intronic
1038801179 8:30750432-30750454 ACCATTGCACTCCAGCAGCCTGG + Intronic
1039293859 8:36127785-36127807 GCTCTTCCCCTGCTGGAGCCAGG - Intergenic
1039792418 8:40886406-40886428 ACCCTTCCTGGGCTGCAGCCAGG - Intronic
1040959752 8:53019210-53019232 ACTTTTCCCCTGCTGAAGCCAGG + Intergenic
1041315319 8:56555374-56555396 TGCCTTGCCCTGCAGGAGCCTGG + Intergenic
1042872048 8:73408284-73408306 GCCATGGCCCTCCTGCAGCCAGG + Intergenic
1047423792 8:124727959-124727981 GCCCTCGCCCTGCCGGAGCCGGG - Exonic
1048321521 8:133404056-133404078 TCTCCTGCCCTGCTGGAGCCTGG - Intergenic
1048585429 8:135770639-135770661 ACCCTTGAACTGCAGCGGCCAGG - Intergenic
1048878072 8:138852224-138852246 ACCCTTTCCCTGTCACAGCCGGG - Intronic
1049265935 8:141667915-141667937 ACCCACGTCCTGCTGCACCCAGG - Intergenic
1049662175 8:143824388-143824410 GCCATTGACCTGCTGCAGGCAGG + Exonic
1049687532 8:143944915-143944937 ACCCAGGCCCCGCTGCAGTCAGG + Intronic
1049720561 8:144113639-144113661 TCTCTTGCCCCTCTGCAGCCAGG + Exonic
1049925935 9:407049-407071 ACCCTTCCCCTTCGGCATCCAGG - Exonic
1051316897 9:15846772-15846794 ACGCTTGTCCTGCTCCAGCTGGG - Exonic
1051623817 9:19079270-19079292 ACCATTGCACTCCTCCAGCCTGG - Intronic
1052546630 9:29888892-29888914 ACTTTTCCCCTGCTGGAGCCAGG + Intergenic
1053072648 9:35110377-35110399 CCCCTTGCCCTGGGGAAGCCAGG + Exonic
1054766047 9:69043457-69043479 ACCATTGCACTCCAGCAGCCTGG - Intronic
1056645489 9:88408319-88408341 ACCCTTGTCATGCTTCATCCTGG + Intronic
1056657059 9:88518333-88518355 ACCATTGCACTCCTGCAGCCTGG - Intergenic
1056666023 9:88581476-88581498 GCCATTGCACTCCTGCAGCCTGG - Intronic
1057173262 9:92976400-92976422 AGCCGTCCCCTGCTGCAGCCAGG - Exonic
1058432002 9:104928073-104928095 CGCCCTGCCCTGCCGCAGCCCGG + Exonic
1058809788 9:108628365-108628387 ACCTTGGCCCAGCTGCAGCTTGG - Intergenic
1059411495 9:114135129-114135151 ACCCTTTCCCTTCAGCAGCTAGG - Intergenic
1060161255 9:121367177-121367199 ACCCTTTCCCTGCGTCTGCCTGG - Intronic
1060929499 9:127479846-127479868 ACTCAGGCCCTGCTCCAGCCGGG - Exonic
1061187433 9:129063119-129063141 GCCCTGGCCCTGCCTCAGCCTGG - Intronic
1061821273 9:133228305-133228327 AGCCCTGCCCTTCTGCACCCCGG + Intergenic
1062059236 9:134486117-134486139 ACCCCTGCCCAGGAGCAGCCGGG - Intergenic
1062137838 9:134939029-134939051 ACCCCTCTGCTGCTGCAGCCTGG + Intergenic
1062392008 9:136337596-136337618 GCCCTGCCCCTGCAGCAGCCCGG - Intronic
1062521061 9:136958128-136958150 AGCCATCCCCTGCTGCAGCCAGG - Intergenic
1062592019 9:137278516-137278538 CCCCTGGCCCTGGGGCAGCCCGG + Intronic
1062744285 9:138201606-138201628 AGCCGTGCCCTGCTGAAGCCTGG + Intergenic
1186762949 X:12742254-12742276 CCTCTTGCTCTGCTGCAACCTGG - Intergenic
1188001612 X:24987768-24987790 ACCCTTTCCCTTCTGCACACTGG - Intronic
1188185723 X:27112222-27112244 ACCATTGCACTCCTCCAGCCTGG - Intergenic
1189839531 X:45059315-45059337 ACCATGGCCATGCTGCAGCCTGG + Exonic
1191104459 X:56764028-56764050 TCTCTTGTCCTGCTTCAGCCTGG - Intergenic
1192941503 X:75917661-75917683 ACACTTACCCTGCTGGTGCCTGG + Intergenic
1193022257 X:76802829-76802851 AACATTGCTCTGCTGCAGCCAGG + Intergenic
1194212127 X:91082299-91082321 ACCCTGGCACTGTTGCAACCTGG + Intergenic
1195043850 X:101038325-101038347 ACCATTGCACTACTCCAGCCTGG + Intronic
1195704775 X:107730854-107730876 ACCTGTGCCCTCCTGCTGCCTGG + Intronic
1196517289 X:116628618-116628640 GCCTTTCCCCTGCTGGAGCCAGG - Intergenic
1197602164 X:128543474-128543496 ACTTTTCCCCTGCTGCAGCCAGG - Intergenic
1197757939 X:130009411-130009433 ACCATTGCACTCCTCCAGCCTGG + Intronic
1199250838 X:145659869-145659891 CCCCTTGCACCACTGCAGCCTGG + Intergenic
1199762132 X:150913021-150913043 ACCCTTGTCCAGCTGCTCCCTGG + Intergenic
1200119104 X:153782030-153782052 ACCCTTCTCCTGCTCCAGCTGGG - Intronic
1200164154 X:154024526-154024548 TCCCTTGACCTGCTGAAGTCCGG - Intronic