ID: 915905335

View in Genome Browser
Species Human (GRCh38)
Location 1:159872882-159872904
Sequence CTGTGGTGCCATCTCTTTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 316}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915905324_915905335 2 Left 915905324 1:159872857-159872879 CCCCCAAATCCCCATGCTTTCCA 0: 1
1: 0
2: 4
3: 43
4: 334
Right 915905335 1:159872882-159872904 CTGTGGTGCCATCTCTTTGCGGG 0: 1
1: 0
2: 1
3: 22
4: 316
915905329_915905335 -7 Left 915905329 1:159872866-159872888 CCCCATGCTTTCCAGCCTGTGGT 0: 1
1: 0
2: 6
3: 76
4: 995
Right 915905335 1:159872882-159872904 CTGTGGTGCCATCTCTTTGCGGG 0: 1
1: 0
2: 1
3: 22
4: 316
915905323_915905335 8 Left 915905323 1:159872851-159872873 CCTTCACCCCCAAATCCCCATGC 0: 1
1: 0
2: 0
3: 51
4: 506
Right 915905335 1:159872882-159872904 CTGTGGTGCCATCTCTTTGCGGG 0: 1
1: 0
2: 1
3: 22
4: 316
915905325_915905335 1 Left 915905325 1:159872858-159872880 CCCCAAATCCCCATGCTTTCCAG 0: 1
1: 0
2: 2
3: 21
4: 259
Right 915905335 1:159872882-159872904 CTGTGGTGCCATCTCTTTGCGGG 0: 1
1: 0
2: 1
3: 22
4: 316
915905322_915905335 9 Left 915905322 1:159872850-159872872 CCCTTCACCCCCAAATCCCCATG 0: 1
1: 0
2: 3
3: 39
4: 403
Right 915905335 1:159872882-159872904 CTGTGGTGCCATCTCTTTGCGGG 0: 1
1: 0
2: 1
3: 22
4: 316
915905327_915905335 -1 Left 915905327 1:159872860-159872882 CCAAATCCCCATGCTTTCCAGCC 0: 1
1: 0
2: 2
3: 25
4: 239
Right 915905335 1:159872882-159872904 CTGTGGTGCCATCTCTTTGCGGG 0: 1
1: 0
2: 1
3: 22
4: 316
915905326_915905335 0 Left 915905326 1:159872859-159872881 CCCAAATCCCCATGCTTTCCAGC 0: 1
1: 0
2: 2
3: 15
4: 207
Right 915905335 1:159872882-159872904 CTGTGGTGCCATCTCTTTGCGGG 0: 1
1: 0
2: 1
3: 22
4: 316
915905331_915905335 -9 Left 915905331 1:159872868-159872890 CCATGCTTTCCAGCCTGTGGTGC 0: 1
1: 0
2: 2
3: 21
4: 315
Right 915905335 1:159872882-159872904 CTGTGGTGCCATCTCTTTGCGGG 0: 1
1: 0
2: 1
3: 22
4: 316
915905321_915905335 15 Left 915905321 1:159872844-159872866 CCATGGCCCTTCACCCCCAAATC 0: 1
1: 0
2: 4
3: 26
4: 294
Right 915905335 1:159872882-159872904 CTGTGGTGCCATCTCTTTGCGGG 0: 1
1: 0
2: 1
3: 22
4: 316
915905319_915905335 30 Left 915905319 1:159872829-159872851 CCCTGAGCATCTCTGCCATGGCC 0: 1
1: 0
2: 4
3: 47
4: 508
Right 915905335 1:159872882-159872904 CTGTGGTGCCATCTCTTTGCGGG 0: 1
1: 0
2: 1
3: 22
4: 316
915905320_915905335 29 Left 915905320 1:159872830-159872852 CCTGAGCATCTCTGCCATGGCCC 0: 1
1: 0
2: 4
3: 23
4: 225
Right 915905335 1:159872882-159872904 CTGTGGTGCCATCTCTTTGCGGG 0: 1
1: 0
2: 1
3: 22
4: 316
915905330_915905335 -8 Left 915905330 1:159872867-159872889 CCCATGCTTTCCAGCCTGTGGTG 0: 1
1: 0
2: 1
3: 61
4: 718
Right 915905335 1:159872882-159872904 CTGTGGTGCCATCTCTTTGCGGG 0: 1
1: 0
2: 1
3: 22
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915905335 Original CRISPR CTGTGGTGCCATCTCTTTGC GGG Intronic
900165977 1:1244537-1244559 CTGGGGTCCCAGCTCTCTGCAGG - Intronic
900882853 1:5394315-5394337 CTGTGGTGCCCTCTAGTTGCAGG - Intergenic
900971717 1:5995622-5995644 CTATGGGGCCATCTCTTTGAAGG - Intronic
900994893 1:6115631-6115653 CTGAGGTCCCATTTCCTTGCTGG - Intronic
901273066 1:7968636-7968658 CTGTGGTCCCATCTACTTGGGGG - Intronic
902184330 1:14713831-14713853 CTGTGGTCCCAGCTGTTTGAGGG + Intronic
902600549 1:17537952-17537974 CTGTAGTGCCAGCTACTTGCAGG + Intergenic
902610664 1:17595459-17595481 CTGGGGAGCCATCTCTGTACAGG - Intronic
902703555 1:18189573-18189595 CAGTGGGGCCATCTAGTTGCAGG - Intronic
903119453 1:21205582-21205604 CTTTGGATCCTTCTCTTTGCAGG - Intergenic
903377627 1:22876588-22876610 CTGGGGCTCCATCTCCTTGCAGG + Intronic
903442499 1:23398887-23398909 CTGTGGTCCCAGCTCCTTGGAGG - Intronic
903595701 1:24492582-24492604 CTGTGGTCCCAGCTCTTAGGAGG - Intergenic
903665979 1:25007886-25007908 CTGTAGTGCCATCTGCTTGCGGG - Intergenic
905421481 1:37848816-37848838 CTGTGATTACATTTCTTTGCAGG - Intronic
905565732 1:38963171-38963193 CTGTGATCCCAGCACTTTGCGGG + Intergenic
905726966 1:40260181-40260203 CTGTGGTCCCAGCTATTTGGGGG - Intronic
905928027 1:41765868-41765890 ATGTTGTGGCCTCTCTTTGCGGG + Intronic
906151256 1:43588942-43588964 CTGTGTGGCCATCTCCTCGCTGG + Exonic
907018750 1:51044151-51044173 CTGTAGTCCCAGCTCTTTGAAGG - Intergenic
907464891 1:54628379-54628401 CTGTGATCCCAGCACTTTGCGGG + Intronic
907490716 1:54807198-54807220 CTGTGGGTCCAGCTCTGTGCTGG - Intronic
908865870 1:68548088-68548110 CTGGGGAGCCACCTCTTTTCTGG - Intergenic
908883186 1:68756849-68756871 CTGTGGTGCCAGCTACTTGGGGG + Intergenic
909158677 1:72115830-72115852 CTGTGGTGCCATCCTTATGGTGG + Intronic
909694175 1:78446722-78446744 CTGTCATGCAAACTCTTTGCTGG - Intronic
911275671 1:95854549-95854571 CAGGGGTGCCAGCTCTCTGCAGG - Intergenic
912473431 1:109921384-109921406 CTGGGATCCCATCTCTTTCCTGG + Intronic
913233247 1:116759538-116759560 TTGTGGTGCAATCTCTGTGCGGG + Intronic
915445593 1:155972822-155972844 CTGTGGTCCCAGCTATTTGGAGG - Intronic
915541612 1:156570630-156570652 CTGTGGTCCCAGCTATTTGGTGG - Intronic
915905335 1:159872882-159872904 CTGTGGTGCCATCTCTTTGCGGG + Intronic
917145701 1:171888690-171888712 CAGTGGTGTCATCTCTTTGAAGG + Intronic
917506864 1:175635156-175635178 CTGTTGGGCCAGCTCCTTGCAGG - Intronic
918376476 1:183914169-183914191 CTGTGATTCCATCTCCTTCCTGG - Intronic
918787451 1:188780962-188780984 TTGTGGAGCCAACTCTTTGATGG + Intergenic
920280331 1:204838674-204838696 CTGTGGTGTCAGATGTTTGCAGG + Intronic
920439768 1:205972176-205972198 CTGTGCACCAATCTCTTTGCTGG + Intergenic
920864542 1:209740947-209740969 CTGTGGTCCCATCTCTCTGGAGG - Intergenic
923041712 1:230324276-230324298 CTGTCGTGCCTGCTCTGTGCTGG - Intronic
923087549 1:230712968-230712990 CTGTGGTGCCTGCCATTTGCAGG + Intronic
924189725 1:241537977-241537999 CTGTTCTTCCATCTCCTTGCTGG - Intronic
1063420051 10:5905257-5905279 CTGTAATGCCAGCACTTTGCGGG + Intronic
1064154105 10:12889339-12889361 CTCTGATGCCATCACATTGCAGG - Intergenic
1064565102 10:16631840-16631862 CTGGGGTGCCCCCTCTGTGCTGG - Intronic
1064623041 10:17234235-17234257 CTGTGGTTCCAGCTCTTAGGGGG - Intronic
1064662563 10:17620504-17620526 GTGTGGTGCTATCTCATTGTGGG - Intergenic
1065318812 10:24489739-24489761 CTGTGGTGCCAGCTACTTGGGGG + Intronic
1065620342 10:27574702-27574724 CTGTGGTCCCATCTTCCTGCTGG + Intergenic
1068033082 10:51727181-51727203 CTGTGGTCCCAGCTATTTGGGGG + Intronic
1068887285 10:62110635-62110657 TTGTGATGCCTTTTCTTTGCGGG - Intergenic
1069033794 10:63627414-63627436 CTGTAGTCCCAGCTATTTGCGGG + Intergenic
1069327422 10:67248536-67248558 CTGTAGTCCCAGCTCTTTGGGGG - Intronic
1070609481 10:77923633-77923655 CTGTGGTCCCAGCTACTTGCGGG + Intronic
1070883010 10:79865796-79865818 CTATGGTGCCAGCCCTGTGCTGG + Intergenic
1071316485 10:84405152-84405174 ATGTGGTTCCATTTCTTTTCTGG - Intronic
1071649578 10:87382111-87382133 CTATGGTGCCAGCCCTGTGCTGG + Intergenic
1071902890 10:90139847-90139869 ATGTGGTTCCCTCTCTTGGCTGG + Intergenic
1071918358 10:90321930-90321952 ATGTGGTGACATCTATTTGCAGG - Intergenic
1073278231 10:102331524-102331546 CTGTAGTCCCATCACTTTGAGGG + Intronic
1074257039 10:111812991-111813013 CTGTGGTGACCTCTCCTTGGGGG + Intergenic
1075080505 10:119380520-119380542 CTGTGATTCCATCTCCTTGGTGG - Intronic
1076134312 10:128035103-128035125 CTGTGGTCCCAGCTACTTGCTGG - Intronic
1077462857 11:2719371-2719393 CTGTGGTCCCAGCTGTTTGGGGG + Intronic
1078257021 11:9666978-9667000 CTGTAGTCCCAGCACTTTGCAGG - Intronic
1078609713 11:12809750-12809772 CTGTGGAGACTTCTGTTTGCAGG + Intronic
1079510784 11:21207371-21207393 CTGAGGTTCTTTCTCTTTGCAGG + Intronic
1079820514 11:25121668-25121690 CTGTGGTGCAACCTCAGTGCAGG - Intergenic
1079887583 11:26006606-26006628 CTTTAGTGCCACCTGTTTGCTGG - Intergenic
1080010844 11:27458005-27458027 CTGTAGTCCCATCTATTTGGAGG + Intronic
1080709748 11:34735231-34735253 CTGAGGTCCCATTTTTTTGCTGG - Intergenic
1080925556 11:36752542-36752564 CTGTGGTCCTATGTCTCTGCTGG + Intergenic
1081429997 11:42966517-42966539 CTGTGTTGCAAATTCTTTGCTGG - Intergenic
1081487268 11:43541062-43541084 CTGTGGTCCCAGCTTTTTGTTGG - Intergenic
1083063645 11:59900173-59900195 CTGTAGTCCCAGCTCCTTGCAGG + Intergenic
1084078142 11:66798475-66798497 CTGTGGTCCCATCTACTTGAGGG + Intronic
1084791107 11:71475652-71475674 CTGTGGTCCCTTCTCTGTGGAGG - Intronic
1084837599 11:71813924-71813946 CTGTGCTGCCACCTCATGGCCGG - Intergenic
1087776735 11:102263434-102263456 TGATGGTCCCATCTCTTTGCAGG + Intergenic
1088230667 11:107670518-107670540 CTGGGATGCAACCTCTTTGCTGG + Intergenic
1088277791 11:108106967-108106989 TTGTGTTGCCATCTCGTTGCCGG + Exonic
1089173787 11:116534210-116534232 CTGTGTTGGCATCTCTTTCTTGG - Intergenic
1089584659 11:119502659-119502681 CTCTGGTGCCTTCTCATTCCAGG - Intergenic
1089595319 11:119575167-119575189 CTGTGGTACCATCTTCTGGCTGG + Intergenic
1089852992 11:121516405-121516427 CTGTGTGGCCATCTCTTTAAAGG - Intronic
1090387969 11:126367436-126367458 CTGAGGACCCCTCTCTTTGCTGG + Intronic
1090390608 11:126384882-126384904 CTGAGGACCCCTCTCTTTGCTGG + Intronic
1090640414 11:128724944-128724966 CTTTTATGCCGTCTCTTTGCTGG - Intronic
1091408325 12:222729-222751 CTGTGATGTCATCTCTTTATGGG - Intronic
1091531089 12:1356079-1356101 CTGTGGTCCCAGCTACTTGCAGG + Intronic
1092082181 12:5725434-5725456 CTTTCGTGCCAGCGCTTTGCCGG + Intronic
1092163714 12:6329884-6329906 GGGTGGTGCCACCTCTCTGCGGG + Exonic
1092401101 12:8180145-8180167 CTGTGCTGCCACCTCATGGCAGG + Intronic
1093494118 12:19735930-19735952 CTGTGGTCCCAGCTATTTGGTGG - Intergenic
1095541014 12:43308616-43308638 CTGTGATCCCAGCACTTTGCAGG + Intergenic
1096019786 12:48314148-48314170 CTCAGGGGCCATCTCATTGCTGG + Intergenic
1098111305 12:67124505-67124527 CTGTGGTACCATCAGTTAGCTGG - Intergenic
1098245976 12:68518256-68518278 CTGTAGTCCCATCTATTTGGGGG - Intergenic
1098394067 12:69999771-69999793 CTCTAGTGCCCTCTCTTAGCAGG + Intergenic
1099117224 12:78642832-78642854 CTGTGATCCCATCACTTTGGGGG + Intergenic
1100870479 12:98905510-98905532 CTGTGATCCCAGCACTTTGCGGG + Intronic
1101378731 12:104193739-104193761 CTGTGATCCCATCACTTTGGGGG - Intergenic
1102103224 12:110297738-110297760 CTGTGGTACCAGCTATTTGGGGG - Intronic
1102853188 12:116270400-116270422 CTGTAATCCCATCACTTTGCGGG - Intronic
1103267726 12:119645004-119645026 GTATTGTGCCATCACTTTGCAGG + Intergenic
1104293720 12:127492720-127492742 CTGTGGCTGCATCTCTATGCAGG - Intergenic
1107190812 13:37583496-37583518 CAGTGGTGCCATCTGCTTCCTGG + Intronic
1107806977 13:44162557-44162579 CTTTGGTGATATCTCTTTGGTGG + Intergenic
1108830871 13:54476605-54476627 CTGTTGTGCCATATCTTTTATGG - Intergenic
1113077651 13:106483804-106483826 CTGTGGAGCTTTCTGTTTGCAGG - Intergenic
1113483707 13:110639614-110639636 CTCTGGTCCCATGTCTTAGCGGG + Exonic
1113941862 13:114022566-114022588 CTGTGGTGCCACTTCCCTGCAGG - Intronic
1116833232 14:49742947-49742969 CTGTGGTCCCAGCTACTTGCGGG + Intronic
1118294519 14:64556960-64556982 CTGTAGTTTCAGCTCTTTGCTGG - Intronic
1119273387 14:73330150-73330172 CTGTAGTCCCAGCTCTTTGGGGG - Intronic
1120743625 14:88134192-88134214 CTTTGCTCCCATCTCTGTGCTGG - Intergenic
1120787028 14:88547529-88547551 CTGTAGTCCCAGCTCTTGGCAGG + Intronic
1121868828 14:97388509-97388531 CTGTGTTGCCATCTCTTACATGG - Intergenic
1122042449 14:98998545-98998567 CTGTGGTCCCAACTATTTGGGGG - Intergenic
1122698369 14:103569685-103569707 CCGTGGTGCCGTCCCTTTGGTGG + Intronic
1124625257 15:31304105-31304127 CTATGGTCCCATCCCTTAGCTGG - Intergenic
1125505800 15:40266868-40266890 CCGTGGTGACATTTCTTGGCAGG + Intronic
1126247472 15:46526337-46526359 CTTTGGTGCAACCTCATTGCAGG - Intergenic
1127799439 15:62465226-62465248 CTCTGGTTCTCTCTCTTTGCTGG + Intronic
1129298858 15:74614436-74614458 CTGTAGTTCCAGCTCCTTGCAGG - Intronic
1129320980 15:74774755-74774777 CTGTGGTCCCAGCTACTTGCTGG + Intergenic
1130329891 15:82913760-82913782 CTCAGGTGCCATCTCTTTTCTGG + Intronic
1133289114 16:4706492-4706514 CTGTGATGCCAGCACTTTGTGGG - Intronic
1133702411 16:8321406-8321428 CTGTGGTTCCAACTCCTTGCGGG - Intergenic
1134086353 16:11360060-11360082 CTGAGGTCCCATTTCCTTGCCGG + Intronic
1134810970 16:17166768-17166790 CTGTGGTCCCAGCACTTTGGAGG - Intronic
1135002481 16:18788609-18788631 CTGTAGTCCCAGCTCTTTGGAGG - Intronic
1135146028 16:19963524-19963546 CTGTTGTCCCAGCTCATTGCCGG + Intergenic
1135940088 16:26814883-26814905 CTGTCGGACCAGCTCTTTGCAGG + Intergenic
1137288674 16:47037318-47037340 CTGTGGTCCCAGCACTTTGGAGG - Intergenic
1137925247 16:52534378-52534400 CTGTAATTCCAACTCTTTGCAGG + Intronic
1138030104 16:53553010-53553032 CTGGGGTCCCGTCTCCTTGCTGG - Intergenic
1141008086 16:80371923-80371945 CTGTGAAGACATCTCATTGCTGG - Intergenic
1141186807 16:81793430-81793452 ATGTGGTGCCACCTGTTTGTGGG + Intronic
1143285419 17:5785498-5785520 CTGTGCTGCCTGCTTTTTGCCGG + Intronic
1146200163 17:30850481-30850503 CTGTGGTTCCAGCTATTTGAGGG - Intronic
1146264105 17:31439731-31439753 CTGTGGTACCAGCTAATTGCGGG - Intronic
1147407194 17:40220516-40220538 CTGTGGTCCCAGCTATTGGCGGG - Intronic
1147809060 17:43154062-43154084 CTGTGGTGCCAGCTACTTGGAGG + Intergenic
1148118756 17:45194844-45194866 CTGTAGTCCCATCACTTTTCGGG + Intergenic
1148251138 17:46081938-46081960 CTGTGATTCCTTCTCTTTCCTGG - Intronic
1150307579 17:64099712-64099734 CTGTGGGGCCTTCCCTTTGAAGG - Intronic
1150793038 17:68214904-68214926 CTGTAGTCCCAGCTATTTGCGGG - Intergenic
1150907435 17:69352717-69352739 CTCTGGTGCCATGTCTGGGCTGG - Intergenic
1151039523 17:70842500-70842522 CTGTGGTGCCATGTATTCCCTGG - Intergenic
1151847039 17:76663855-76663877 CTCTGGTGCCCTCTCTGGGCTGG + Intergenic
1152251071 17:79212839-79212861 CTGAGGTGACATCTGTTTCCAGG - Intronic
1152284177 17:79402945-79402967 CTGATGAGCCTTCTCTTTGCCGG - Intronic
1152739941 17:82014442-82014464 CCGTGGTGCCTTCTCTCTCCCGG + Intronic
1153439782 18:5103481-5103503 CTCTGGTGCCATCTCCAGGCTGG - Intergenic
1154306277 18:13233120-13233142 CAGTGGCGCCACCTCTTTGCAGG + Intronic
1155299578 18:24417221-24417243 CTATGGGGCCATCTAGTTGCAGG - Intergenic
1155463639 18:26111744-26111766 CTGTGGTCCCAGCTATTTGGGGG - Intergenic
1155725255 18:29073260-29073282 CTGTGGTCCCATCTACTTGGTGG + Intergenic
1156326734 18:36080239-36080261 CTGTGATGCCATCTGTCTTCAGG - Intergenic
1157024175 18:43823156-43823178 CTGTATTGGCATCTCTGTGCAGG + Intergenic
1157952783 18:52058421-52058443 CTGTGGTCCCACCTATTTGGAGG - Intergenic
1161054329 19:2182416-2182438 CTGTGGTCCCAGCTACTTGCGGG + Intronic
1161370637 19:3908945-3908967 CAGTGGTGCCATCTCAGAGCGGG - Intronic
1161831352 19:6606907-6606929 CTGTGGTCCCAGCTATTTGGGGG - Intergenic
1163089272 19:15007765-15007787 CTGTGGTCCCAGCACTTTGTGGG + Intronic
1163373803 19:16917616-16917638 CTGTGGTCCCAGCTGCTTGCGGG + Intronic
1164875194 19:31680013-31680035 CTGTGGTCCCAGCTATTTGGGGG - Intergenic
1165044553 19:33094431-33094453 CTGTGGTCCCAGCTACTTGCGGG - Intronic
1165103886 19:33457306-33457328 CTGTGGTGCCAGTTATTTGGGGG + Intronic
1165336913 19:35177119-35177141 CTGTGGTCCCAGCTATTTGAGGG + Intergenic
1165461526 19:35946733-35946755 CTGGAGTCCCATGTCTTTGCAGG + Intergenic
1165470728 19:36003035-36003057 CTGGGGTGTCATCCCATTGCTGG - Intergenic
1166076012 19:40414244-40414266 CTGTGGTCCCAGCTATTTGAGGG - Intergenic
1166090695 19:40506860-40506882 CTGTAGTGCCAGCTATTTGGAGG + Intronic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1167513776 19:49910829-49910851 CAGTGGTGCCATCTATCAGCAGG + Intronic
1168388092 19:55982821-55982843 CTGTGGTCCCAGCTATTTGGGGG + Intronic
1168405358 19:56107737-56107759 CTGTGGTGCCTTCTTTCTGAGGG - Intronic
925093204 2:1171989-1172011 CTGTTGTGCCGTCTATTTCCTGG - Intronic
925148843 2:1600965-1600987 CTGTGGTGCCAGCTCCCTCCAGG + Intergenic
926275764 2:11402047-11402069 CTCTGGTGGCATCCCTTTCCTGG - Intergenic
926461791 2:13139131-13139153 CTGTTGTGCCAGTTCTTGGCTGG - Intergenic
927497810 2:23562487-23562509 ATGTGGTGTCATCTCTGAGCAGG + Intronic
927561565 2:24077172-24077194 CTGTGGTGCCCACTGGTTGCGGG + Intronic
927816177 2:26219571-26219593 CTGTGGTTGCTTCTCTTTGTAGG + Intronic
928520659 2:32085336-32085358 CTGTGGTCCCATCTACTTGGGGG - Intronic
928927066 2:36590731-36590753 CTGTAGGGCCATCACCTTGCTGG - Intronic
929055136 2:37870024-37870046 CCCTGCTGCCATCTCTGTGCTGG - Intergenic
932822362 2:74912255-74912277 CTGGGGTGCTATCTCTCAGCAGG - Intergenic
933560064 2:83877248-83877270 CTGTTTTGCCATCTTTTAGCAGG - Intergenic
935542209 2:104361915-104361937 TCATGGTGCCATCCCTTTGCAGG + Intergenic
938114061 2:128591470-128591492 CTGATGTGCCATCTCTGAGCAGG + Intergenic
938403604 2:131014796-131014818 CTGTCGTGCCATCTCACTGAAGG - Intronic
938904090 2:135822674-135822696 CTGTGGAGCCAACCCATTGCTGG + Intronic
941805075 2:169703949-169703971 CTGAGCTGCCATCCCTTTGAAGG - Intronic
946053738 2:216883977-216883999 CTGTGGTTCCTTTTCCTTGCTGG + Intergenic
946154503 2:217798446-217798468 CTGTGGTCCCAGCTCCTTGGGGG + Intergenic
946226644 2:218267366-218267388 CTTTTGTGCCAGCTCTGTGCTGG - Intronic
946887528 2:224238020-224238042 CTGTGCTGCTCTCTCTTTTCTGG + Intergenic
947660024 2:231859652-231859674 CTGTGGAGCCATATTTTTCCTGG - Intergenic
949061426 2:241960437-241960459 CCCTGCTGCCATCTCTGTGCTGG + Intergenic
1169328597 20:4698134-4698156 CTGTGGTGCAGGTTCTTTGCAGG - Intronic
1169716138 20:8620615-8620637 CTGTGGTCCCAGCTATTTGGGGG + Intronic
1170732757 20:18988732-18988754 CTGTGGTTGTTTCTCTTTGCTGG + Intergenic
1171458869 20:25287275-25287297 CTGTGGTGCCATCAGCCTGCAGG - Intronic
1172106391 20:32519636-32519658 CTGGGGGCCCATCTGTTTGCAGG - Intronic
1172805944 20:37611618-37611640 CGCTGTTTCCATCTCTTTGCTGG + Intergenic
1173286878 20:41680439-41680461 CTGTAGTCCCAACACTTTGCAGG - Intergenic
1173701463 20:45075584-45075606 GTGTGGTGGCATCTCTGTACAGG + Exonic
1173827282 20:46056075-46056097 CTCTGGTGATAGCTCTTTGCAGG + Intronic
1174015063 20:47481199-47481221 CAGTGGTGCAATCTCACTGCAGG + Intergenic
1174194694 20:48764658-48764680 CTGTGGTCCCAGCTCTTGGAAGG + Intronic
1174884803 20:54321905-54321927 CTTTGGTGACATCACTATGCAGG - Intergenic
1176909363 21:14544306-14544328 CTGTAGTTCCAGCACTTTGCAGG - Intronic
1178596520 21:33958264-33958286 CTGTCTTGCCTTCTGTTTGCAGG - Intergenic
1181074362 22:20365436-20365458 CTGTAATCCCAGCTCTTTGCGGG - Intronic
1181490698 22:23259145-23259167 CTTTGGTGTCATGCCTTTGCTGG + Intronic
1181584789 22:23847241-23847263 CTGTAGTTCCAACTCTTTGGGGG + Intergenic
1182663433 22:31941294-31941316 CTGTAGTGCCATCACTTGGGAGG + Intronic
1184152242 22:42645955-42645977 CTGTGGTGCGCCCTCTCTGCCGG - Intronic
1184368639 22:44068664-44068686 CAGTGGTGCCACCTCTTGCCGGG + Intronic
949663674 3:6311607-6311629 CTGTGATTCCATCTCTATTCGGG - Intergenic
950646475 3:14380202-14380224 CTGTAATGCCAGCACTTTGCGGG + Intergenic
953494190 3:43372323-43372345 CTGGGGTGCCGTCTCAGTGCAGG - Intronic
953737683 3:45510289-45510311 CTGTGGTCCCAGCTGCTTGCAGG + Intronic
954000392 3:47552207-47552229 CTGTGGTCCCAGCTCCTTGTGGG - Intergenic
954055440 3:48019752-48019774 CTGTGGTCCCAGCTCTTGGGAGG + Intronic
954544503 3:51421377-51421399 CTGTAATCCCAGCTCTTTGCAGG - Intronic
955382314 3:58449456-58449478 CTGTGGTCCCAGCTATTTGGGGG - Intergenic
957957436 3:87206370-87206392 GTGTTGTGCAATCTGTTTGCAGG - Intergenic
958432528 3:94059455-94059477 CTGTGGTCCCAGCACTTTGGGGG - Exonic
963921015 3:150905563-150905585 GTGTGGAGTGATCTCTTTGCTGG - Intronic
966786881 3:183630420-183630442 CTCGGGTGCCATCTCTTTGGTGG - Intergenic
967178482 3:186883190-186883212 CTGTGGTCCCAGCTGCTTGCGGG - Intergenic
967655116 3:192038803-192038825 CTGTGTGGCCATATCTCTGCGGG + Intergenic
967716292 3:192765696-192765718 CTGTGTTGGCATCTCTTGGTAGG - Intronic
968533296 4:1107510-1107532 CAGTGGCGCCATCTCACTGCAGG + Intronic
969530046 4:7725518-7725540 CTGCGTTCCCATCTCTTTCCCGG - Intronic
969660735 4:8525939-8525961 CTGGGCTGCCATCTCCTGGCTGG + Intergenic
969671373 4:8592151-8592173 CTGTGGCCCCAACTCATTGCTGG - Intronic
969779016 4:9381435-9381457 CTGTGCTGCCACCTCATGGCCGG - Intergenic
970046854 4:11863847-11863869 CTGTGTTCCCATCTGTTTTCTGG - Intergenic
970617297 4:17780478-17780500 CACTGGTGGCATCTTTTTGCTGG + Intronic
972571899 4:40318662-40318684 CTGTGGTCCCAGCTCTCTGGAGG + Intergenic
974818516 4:67036375-67036397 CTGTGGTCCCAGCTCCTTGAGGG + Intergenic
976106765 4:81627402-81627424 CTGAGGTGCCATTCCCTTGCTGG - Intronic
978808148 4:112821888-112821910 CTGTGGTCCCAGCTATTTGGTGG - Intronic
980688531 4:136261111-136261133 CTATGGTGCCATTGCTGTGCTGG + Intergenic
981207089 4:142055294-142055316 CAGTGTTTCCATCTCTTTTCAGG - Intronic
981888672 4:149710770-149710792 CTTAGGTGCCATTTCTTTTCTGG + Intergenic
982000846 4:151019718-151019740 CTGTGGTCCCAGCTATTTGGAGG + Intergenic
982025476 4:151250059-151250081 AATTGGTGCCATCTCTTTGGAGG + Intronic
982390126 4:154854459-154854481 CAGTGGTCCCACCTCTTTTCAGG - Intergenic
984253353 4:177361144-177361166 CTATGGTGCCATCACTTTTTTGG - Intronic
985423012 4:189803167-189803189 CTACGGTGCCATATCTGTGCTGG - Intergenic
985695744 5:1339145-1339167 CTGTGTGGCCATCTCTTCACAGG - Intronic
985846906 5:2356480-2356502 TGGTGGTGCCTTCTCTTTGAGGG - Intergenic
987229388 5:15877595-15877617 ATGTGGAGCCATCTCTCTGTAGG + Intronic
988377621 5:30457391-30457413 CAGTGGTGGCTTTTCTTTGCTGG + Intergenic
988689820 5:33561064-33561086 CGGAGGTGGCATCTTTTTGCAGG + Exonic
999134954 5:149312323-149312345 CTGTTGTGCCAGCTCTGTGCTGG - Intronic
999186312 5:149712709-149712731 CTGTGGTACCAGCTATTTGAGGG - Intergenic
999286603 5:150398043-150398065 CTGTGGTCCCAGCTATTTGGGGG - Intronic
1002018426 5:176345247-176345269 CTGTGATGTCATCTCCTTGCTGG - Exonic
1003583716 6:7366625-7366647 CTGTGGTTGCAACTCATTGCTGG + Intronic
1006498028 6:34438044-34438066 CTGTGAAGCCATCTTTTTGTGGG + Intergenic
1007815971 6:44525891-44525913 CTTTGCTCCCATCACTTTGCTGG + Intergenic
1009614547 6:65988708-65988730 CAGTGGTGCCATCTCTGCTCAGG - Intergenic
1010470621 6:76223515-76223537 GTGTGGTGCCATTTCTTTGAAGG + Intergenic
1010500566 6:76594291-76594313 CTGTGATGCAATCTCTCTTCAGG - Intergenic
1011615906 6:89198314-89198336 CTGTGGAGCCATCACTTGGCTGG + Intronic
1013067095 6:106694506-106694528 CTGTGATGCCTTCTCTGTGGCGG + Intergenic
1013609936 6:111785181-111785203 CTGTTTTGCTATCTCTTTCCTGG + Intronic
1014523254 6:122471285-122471307 CTCTGTTGTCATCTCTTTCCTGG - Intronic
1015388683 6:132655500-132655522 CTGTGGTTCCATCTATTTAGGGG - Intergenic
1015936598 6:138411000-138411022 CTGAGGTGTCATCTCTTTTAAGG - Intronic
1017744146 6:157431849-157431871 TTGTGGTCCCAGCTATTTGCAGG - Intronic
1019157107 6:170046428-170046450 TTGTGATGCCAGCTCTTTGTGGG + Intergenic
1019169306 6:170122916-170122938 CTGAGGTCCCATTTCCTTGCTGG - Intergenic
1020606322 7:10341844-10341866 CTGTGGAGACATATCGTTGCAGG - Intergenic
1021310961 7:19095238-19095260 CTGTTGTGCCTTTTCTTTGAAGG - Intronic
1023949643 7:44832825-44832847 CTGTGGTCCCAGCTATTTGCAGG + Intronic
1024934990 7:54702718-54702740 CTGTGGTCCCAACTCTCTGGAGG - Intergenic
1025168518 7:56735103-56735125 CTGTGGTCCCAGCTATTTGGGGG + Intergenic
1025703868 7:63844784-63844806 CTGTGGTCCCAGCTATTTGGGGG - Intergenic
1026931142 7:74223632-74223654 CTGTCCTGCCTTCCCTTTGCAGG - Intronic
1030001664 7:105070688-105070710 CTGTGGTCCCAGCTCTTTGGGGG + Intronic
1030274186 7:107702006-107702028 CTGTGGAGCTATATCTTTCCTGG + Exonic
1031616809 7:123891026-123891048 CTGTGGTGTTTTCTCTTTGTGGG + Intergenic
1032042237 7:128572945-128572967 CTGTGGTGCCAGCTACTTGGAGG - Intergenic
1032924564 7:136588816-136588838 CTGTGCTGCCATATCTTTCAAGG + Intergenic
1033275817 7:139971022-139971044 CTCTGATGCCATTTCTTTGGTGG + Intronic
1034316562 7:150138612-150138634 TGGTGGTGGCATCACTTTGCTGG - Intergenic
1034733943 7:153412026-153412048 CTGTTTTGCCATCTTTTAGCAGG - Intergenic
1035011156 7:155716210-155716232 CTGAGGTGGCATCTCTTGGGTGG + Intronic
1035348405 7:158225004-158225026 GTGTGGTGGCATCTCATTGTGGG - Intronic
1035429487 7:158807941-158807963 CCGTGGCGCCATCCTTTTGCGGG - Intronic
1036041562 8:5087951-5087973 CTGTGGAGCTCCCTCTTTGCTGG - Intergenic
1036344884 8:7954951-7954973 CTGTGCTGCCACCTCATGGCCGG + Intergenic
1036620815 8:10423671-10423693 CTGTGGTGCTGTGTCCTTGCAGG - Intronic
1036862013 8:12361955-12361977 CTGTGCTGCCACCTCATGGCCGG + Intergenic
1038795202 8:30703622-30703644 CTGTAGTCCCAGCTCTTTGAGGG + Intronic
1039135735 8:34321030-34321052 CTGTGGTTCCATTTCCTTGCTGG + Intergenic
1039506289 8:38054782-38054804 CAGTGGTGCCCTCTCTTTGCAGG - Intronic
1039867239 8:41516218-41516240 CTGTGGTCCCAGCTACTTGCAGG + Intergenic
1040078891 8:43267967-43267989 CTGTGGTCCCAGCAATTTGCGGG - Intergenic
1041529601 8:58850271-58850293 CTGCTGTGCCTTCTCTTTCCAGG - Intronic
1043023430 8:75035767-75035789 CTGTGGTCCCAGCACTTTGTGGG + Intergenic
1044739265 8:95309096-95309118 CTGTGCTGCCATCTGTTAGAAGG + Intergenic
1046931408 8:119845340-119845362 CTGTAGTCCCAGCCCTTTGCAGG - Intronic
1049535210 8:143177037-143177059 CTGTAATCCCATCTCTTTGAAGG - Intergenic
1049959411 9:723978-724000 CTGTGGTCCCAGCTATTTGGGGG + Intronic
1052473055 9:28924341-28924363 CTGTGGTCCCAGCTATTTGTGGG - Intergenic
1052683135 9:31720183-31720205 CTGTGCTGCAAGCTCTTTGAGGG - Intergenic
1052819711 9:33129127-33129149 CTGTGGAGCCTTCCCTCTGCAGG + Intronic
1054727801 9:68669188-68669210 CATTGGTGCTATCTTTTTGCAGG + Intergenic
1056062202 9:82895218-82895240 CTGAGGTGCCATTTCCTTTCAGG - Intergenic
1057828698 9:98390914-98390936 TTGTGGAGCCATCATTTTGCAGG - Intronic
1058122720 9:101156425-101156447 CTGTGGTCCCAACTATTTGGGGG + Intronic
1058622244 9:106895793-106895815 CTGTAATGCCATCTTTTTGGGGG + Intronic
1058876217 9:109247121-109247143 CTGTAGTGCCAGCTATTTGGGGG - Intronic
1059359439 9:113729356-113729378 CTGTAGTCCCAGCTATTTGCGGG - Intergenic
1059824134 9:118008221-118008243 CAGAGGTGCCATCTCTATGAAGG - Intergenic
1062384090 9:136302132-136302154 GTATGGTGCAATCTCATTGCGGG - Intronic
1185889273 X:3809962-3809984 CTGTGGTGCCAGCTACTTGGGGG + Intergenic
1187723125 X:22172659-22172681 CTGTAGTGCCTCCTATTTGCAGG + Intronic
1188113886 X:26221686-26221708 CTGTGGTGCCTTCTCTGTTCTGG - Intergenic
1189274790 X:39777921-39777943 CTGTGGTGCCAGCTTTTGCCAGG - Intergenic
1190034088 X:47004550-47004572 CTGTGGTCCCAGCTCTTGGGAGG - Intronic
1190154197 X:47974263-47974285 CACTGGGGCCATCTCTTTGCTGG - Intronic
1192388334 X:70696989-70697011 CTGAGGTCCCATTTCCTTGCTGG + Intronic
1192856810 X:75020742-75020764 CTGTGGTCCCAGCTCTCGGCTGG - Intergenic
1195042975 X:101031092-101031114 CTGTAGTCCCAGCTCCTTGCAGG - Intronic
1198618221 X:138481003-138481025 CTGTGGTGCCTTCTCTATCTGGG - Intergenic
1198932660 X:141878464-141878486 CTGTGGATCCTTCTCTTTGTGGG - Intronic
1199290716 X:146102138-146102160 CTGTGGTCCCAGCTATTTGGTGG + Intergenic
1199659733 X:150037048-150037070 CTGTTCTGCCATCTCTTAGCAGG - Intergenic
1201770273 Y:17611824-17611846 CTGTTTTGCCATCTTTTAGCAGG + Intergenic
1201831281 Y:18294163-18294185 CTGTTTTGCCATCTTTTAGCAGG - Intergenic