ID: 915905411

View in Genome Browser
Species Human (GRCh38)
Location 1:159873284-159873306
Sequence AAATGGGGCTGGAGCCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 0, 2: 11, 3: 71, 4: 478}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915905411 Original CRISPR AAATGGGGCTGGAGCCCAGA GGG (reversed) Intronic
900236641 1:1594749-1594771 CCATGGAGCTGGAGCGCAGATGG - Intergenic
900417927 1:2543552-2543574 TGATGGGGCTGGAGCCCAGTGGG - Intergenic
900522575 1:3112846-3112868 TGATGGGGCTGGAGCCCAGGCGG - Intronic
901148123 1:7081971-7081993 AAATGGGGCTTGAAACCAAATGG - Intronic
901540558 1:9912504-9912526 ATATGTGGCTAGAGCCCAGTTGG - Intergenic
901886320 1:12225800-12225822 GAATGGGGCTGGTTTCCAGAGGG - Intergenic
901929809 1:12589947-12589969 AGATGGAGGTGGAGACCAGATGG - Intronic
902097511 1:13958807-13958829 CAATGTGGCTGGAGCCAAGGCGG + Intergenic
902393340 1:16118952-16118974 AAATGGGGCCCGGGCCCAGCAGG + Intergenic
902878461 1:19355040-19355062 CAGAGGGGCTGGAGGCCAGAAGG - Intronic
902885809 1:19403894-19403916 AACTGCGGCTGGAGTCCAGGAGG - Intronic
903573450 1:24322724-24322746 AAACGGGGCTGAAACCCAGATGG + Intronic
903624456 1:24720926-24720948 AAATGGGGCAGGAGGGCAGAAGG + Intergenic
904832917 1:33316744-33316766 GAAGGGGGCTGGAGCCCAGAAGG + Intronic
904878104 1:33671994-33672016 AAAGGGGGGTGGAGCCAAGATGG + Intronic
905237875 1:36562478-36562500 ACAGGAGGCTGCAGCCCAGAGGG - Intergenic
905276967 1:36824686-36824708 GGCTGGGGCTGGAGCCCAGAGGG + Intronic
905942503 1:41875164-41875186 GGATGGTGCTGGAGCCCTGAAGG - Intronic
906182696 1:43835553-43835575 AGAGGGAGCTGGAGCCCAGCAGG - Intronic
907470767 1:54672055-54672077 CAGTGTGACTGGAGCCCAGAGGG + Intronic
909658242 1:78054667-78054689 AAATGAGGCTGGTGCTCAGGAGG - Intronic
910213037 1:84813552-84813574 AAATGGTGCCAGAACCCAGAAGG + Exonic
911226093 1:95307224-95307246 AGATGGGGCTGGAGACGAAACGG - Intergenic
911508438 1:98783538-98783560 AATTGGGGGTGGAGCCAAGATGG + Intergenic
911722157 1:101203132-101203154 ACATGGAGTTGGAGCCCACATGG - Intergenic
912530121 1:110314535-110314557 AAAGAGCCCTGGAGCCCAGACGG + Intergenic
912741838 1:112205284-112205306 AAAGGGGGATGGAGCCAAGATGG - Intergenic
913078609 1:115361109-115361131 AAAAGGAGCTGGAGCCAAGAAGG - Intergenic
913658219 1:120982078-120982100 AAATGAGGTAGGAGACCAGAAGG - Intergenic
914009577 1:143765167-143765189 AAATGAGGTAGGAGACCAGAAGG - Intergenic
914522795 1:148433363-148433385 AAATGAGGTAGGAGACCAGAAGG - Intergenic
915046277 1:153019447-153019469 GAATGGGGCTGAAGCTGAGATGG + Intergenic
915905411 1:159873284-159873306 AAATGGGGCTGGAGCCCAGAGGG - Intronic
917448942 1:175130506-175130528 AAATTGGGCTGCAGGCCTGAAGG - Intronic
917710328 1:177677929-177677951 TAATAGGGGTGGAGCCAAGATGG - Intergenic
918506324 1:185257788-185257810 AAATTGGACAGGAGCCAAGATGG - Intronic
919378822 1:196829004-196829026 AAATAGGACTGAAACCCAGAGGG - Intronic
920386740 1:205575168-205575190 AAAAGGGGCAGCAGCCCAGAAGG - Intronic
920541254 1:206779786-206779808 CAATGAGGCTGGAGTGCAGAGGG - Intergenic
921678168 1:218000536-218000558 AAATTTGGCTGGAGAGCAGAAGG - Intergenic
924218278 1:241847884-241847906 AACTGGGGCTGCAGCCAGGAGGG + Intergenic
924882189 1:248172571-248172593 AAAGGGGGGAGGAGCCAAGATGG - Intergenic
1064253347 10:13723860-13723882 AAGCGGGGATGGAGCTCAGATGG + Intronic
1065145454 10:22763641-22763663 TGATGAGGATGGAGCCCAGAGGG + Intergenic
1065150538 10:22818069-22818091 GACTGAGGCTGGAGCCCAGGAGG - Intergenic
1066465018 10:35642851-35642873 AACTGGGGCTGGACCCGGGACGG + Intergenic
1067007515 10:42678988-42679010 AAATGGGGGTTGAGCACAGGTGG + Intergenic
1068984815 10:63097796-63097818 AGATGGGACTTGAGCCCAGGAGG - Intergenic
1069653203 10:70066513-70066535 AACTGGAGCTGGAGGTCAGAGGG + Intronic
1070290588 10:75111258-75111280 AAATGGGGTTAGGGCCTAGAAGG - Intronic
1070788957 10:79178484-79178506 AGTTGGAGCTGGAGCCCAGCTGG + Intronic
1070892956 10:79956162-79956184 AAATGGGGATGGAGCCAAGATGG + Intronic
1070917675 10:80165291-80165313 GAGTCAGGCTGGAGCCCAGAAGG - Intronic
1071105542 10:82089889-82089911 CACTGGGGCAGGAGCCTAGAAGG - Intronic
1071806276 10:89124605-89124627 AAATGCTGCTGGAGCTCAGAGGG + Intergenic
1072029300 10:91503260-91503282 AAATGAGGGAGGAGCCAAGATGG + Intronic
1072391579 10:94992935-94992957 ATCAGGGGCTGGAGGCCAGAAGG + Intergenic
1073016770 10:100406327-100406349 AAAAGAGGGTGGAGCCAAGATGG + Intergenic
1073841375 10:107502772-107502794 AAATGAGGGTGGATCCCATAAGG + Intergenic
1073987233 10:109223617-109223639 AAATAGGGGAGGAGCCAAGATGG + Intergenic
1074030989 10:109687696-109687718 AAATGGAGGTGGAGCCAAGATGG - Intergenic
1074118730 10:110477428-110477450 AAATAGAACTGGAGGCCAGAGGG - Intergenic
1074179154 10:111043137-111043159 GATTGGGGGTGGAGCCAAGATGG + Intergenic
1074303120 10:112250893-112250915 AACAGGGGGTGGAGCCAAGATGG + Intergenic
1074819603 10:117168354-117168376 GAGTGGGGATGGAGCCCCGAGGG - Intergenic
1075205579 10:120445065-120445087 AAATGGGGGTGGTTCCAAGATGG + Intergenic
1075600133 10:123761635-123761657 AACTGGGGCTGGAGACCCAAAGG - Intronic
1076571518 10:131436246-131436268 ATTTGAGGCTGGAGCCCAGCAGG + Intergenic
1076600613 10:131654735-131654757 ACAGGGGGCTGGGGCGCAGAGGG + Intergenic
1076706563 10:132305272-132305294 AAATGGTTCTGGAGTCCACAAGG + Intronic
1077076857 11:706006-706028 GGCTGGGGCTGGAGCCCAGGCGG + Intronic
1077281960 11:1749846-1749868 AAAGGGGGCAGGAGCTCCGATGG - Intronic
1077442587 11:2575506-2575528 AGAAGGGGCAGCAGCCCAGATGG + Intronic
1077465722 11:2732867-2732889 AGATGGGGCTGGGGCCCATGGGG - Intronic
1077547941 11:3184119-3184141 AAATGGGGCTGGTGCCACCAAGG + Intergenic
1077591918 11:3499033-3499055 TAGTGGGGGTGGAGCCAAGATGG - Intergenic
1077697436 11:4406922-4406944 AGAGGGGGGTGGAGCCAAGATGG - Intergenic
1078143855 11:8710067-8710089 GAAGGGGGCAGGAGCCCTGAAGG - Intronic
1080327897 11:31099627-31099649 AAATGGGGTTGGGGTACAGAAGG + Intronic
1080897636 11:36459535-36459557 AGCTGGGACTGGAGCACAGATGG - Intronic
1081443065 11:43101133-43101155 AAATGGGGGTGGAGCCAAGATGG - Intergenic
1081586326 11:44386523-44386545 GGATGGAGATGGAGCCCAGAGGG - Intergenic
1081976888 11:47241092-47241114 AGATGGGGCAGGAGACCAGATGG + Intronic
1082134733 11:48534057-48534079 ACAGGGGGGTGGAGCCAAGATGG - Intergenic
1082152011 11:48750697-48750719 AAGTGGGGGAGGAGCCAAGATGG - Intergenic
1082253212 11:50004983-50005005 ATATAGGGGTGGAGCCAAGATGG + Intergenic
1082275064 11:50212454-50212476 ATATGAGGCTGGAAACCAGATGG + Intergenic
1082313915 11:50694425-50694447 ATATGTGGTTGGAGCCAAGATGG + Intergenic
1083344662 11:61980913-61980935 AAACGGGGCCCGAGCCCTGATGG - Intergenic
1083427486 11:62596034-62596056 GAATGGGGCTGGATTTCAGAAGG - Exonic
1083513795 11:63236787-63236809 AGAAGGGGGTGGAGCCAAGATGG - Intronic
1084122739 11:67078655-67078677 AAAGGAGGCTGGAGAGCAGAGGG - Intergenic
1084209635 11:67615046-67615068 GAGTGGGGCTGGAGCACAGGTGG - Intergenic
1084247757 11:67871769-67871791 TAGTGGGGGTGGAGCCAAGATGG - Intergenic
1084662866 11:70557462-70557484 CAGTGGGGGAGGAGCCCAGATGG + Intronic
1084864012 11:72041216-72041238 CAGTGGGGGTGGGGCCCAGAGGG + Intronic
1085296687 11:75435374-75435396 ACAAGGGGCTGGAGCCCACAAGG + Exonic
1085621384 11:78040514-78040536 AAATGAGGCTGGATTCCAGGCGG - Intronic
1086282014 11:85200791-85200813 GACTGGGGCTGGAGCTGAGAGGG - Intronic
1086976252 11:93136635-93136657 ACATGGGGGAGGAGCCAAGATGG + Intergenic
1087679370 11:101202374-101202396 AAATTGGGCTGGAGTCTAGCTGG - Intergenic
1087878999 11:103392615-103392637 AGATAGGGGTGGAGCCAAGATGG - Intronic
1087904942 11:103684736-103684758 AACTGGGGCTGCAACCCAGTAGG - Intergenic
1088913273 11:114208123-114208145 CTATGGTGCTGGAGACCAGAAGG - Intronic
1088924365 11:114285361-114285383 AAATGAGGCTGCAGACCATAAGG - Intronic
1089079182 11:115761740-115761762 AGATGGGACTGGAGCTCAGGGGG - Intergenic
1089338751 11:117743586-117743608 AACTGGGCCTGGAGCCCAGAGGG - Intronic
1089567611 11:119380350-119380372 AAAGGGGGAAGGAGCCCAGATGG - Intronic
1090386403 11:126359859-126359881 AAATGTGGCTGCCGCCCACATGG + Intronic
1090740922 11:129659155-129659177 GAATGGGGCTGAAGCTGAGATGG + Intergenic
1091936720 12:4440751-4440773 AGATGGGGCTGGAGAGCAGCGGG - Intronic
1092209554 12:6637521-6637543 GAGTGTGGCTGGAGCCCAGGAGG + Intergenic
1092566779 12:9674061-9674083 AAAGGGGGCTGAAGCCAAGGAGG - Intronic
1092912762 12:13162555-13162577 CAATGAGGCTGGAGCTGAGAGGG - Intergenic
1093750504 12:22793483-22793505 AAAGATGGCTTGAGCCCAGAAGG + Intergenic
1094096838 12:26714942-26714964 AAATGGCACTGGAGTCAAGATGG - Intronic
1094451576 12:30588350-30588372 AAATGAGGGTGGAGCCAAGATGG + Intergenic
1094524831 12:31224717-31224739 AAAAGAGGCTGGAGCCCTGAAGG + Intergenic
1094561320 12:31556187-31556209 AAAGGGGGGAGGAGCCAAGATGG - Intronic
1094861400 12:34470176-34470198 AAATGGAGGAGGAGCCAAGATGG - Intergenic
1095165761 12:38969586-38969608 ATAGAGGGCTGGAGCCAAGATGG - Intergenic
1095966515 12:47870725-47870747 CAGTGGAGATGGAGCCCAGAGGG - Intronic
1097344678 12:58477542-58477564 AGATGAGGCTGGAGCCAAGATGG - Intergenic
1097661396 12:62435317-62435339 AAATGGGCTAGGAGCCCCGAGGG + Intergenic
1099443263 12:82723891-82723913 AAGTGGGGCTGGAACTCAGGTGG - Intronic
1099475481 12:83103571-83103593 AAATGGGGGTGGATCCCTCATGG - Intronic
1101029134 12:100642949-100642971 AGAGGGGGGTGGAGCCAAGATGG - Intergenic
1101460623 12:104889110-104889132 ATATTGGGCTGGATTCCAGAAGG - Exonic
1101568391 12:105931159-105931181 AAAGGTGGCTGGGGCTCAGATGG + Intergenic
1101939100 12:109086065-109086087 AACTGGGGCTGGCTCCCAGGTGG - Exonic
1102520061 12:113472400-113472422 ACACGGGGCTGGGGCCCAGCCGG + Intergenic
1103230356 12:119325230-119325252 AAATGAAGCTGCAGCCAAGAGGG + Intergenic
1104041442 12:125133865-125133887 GCATGGGGCTGGGGGCCAGAGGG - Intronic
1104159159 12:126161938-126161960 ATATGTGAGTGGAGCCCAGAGGG - Intergenic
1106139776 13:27002465-27002487 GAATGTGGCTGGAGCTCACAGGG - Intergenic
1106142608 13:27023849-27023871 AATAGGGCCTGGGGCCCAGAAGG + Intergenic
1106412184 13:29518209-29518231 AAATGTGGCTGCAGGCTAGATGG + Intronic
1107314676 13:39118962-39118984 GAATGGGGCTGCAGCTGAGATGG - Intergenic
1108074763 13:46668357-46668379 AAGTGGAACTGCAGCCCAGAGGG - Intronic
1108416490 13:50202688-50202710 AAATGGAGCTGGAGTGCAAAGGG + Intronic
1108446111 13:50510608-50510630 TTATGGGGCTGGAGTTCAGAAGG + Intronic
1108565876 13:51696311-51696333 ATTGGGGGCTGGAGCCAAGATGG - Intronic
1108689938 13:52850906-52850928 AAATGGGGCCGGAGTCCCAAAGG + Intergenic
1109323027 13:60833328-60833350 CCATGGGGGTGGAGCCAAGATGG - Intergenic
1110152500 13:72271607-72271629 ATATAGGGGTGGAGCCAAGATGG - Intergenic
1110188145 13:72699244-72699266 ACATGGGGCTGGATGCCATATGG - Intergenic
1113107201 13:106784386-106784408 AAAAGGGGCTGGAGCCAAGATGG - Intergenic
1113415177 13:110123440-110123462 ACCTCGGGCTGGAGCCCAGCAGG + Intergenic
1113439264 13:110314993-110315015 AAAGGGGCCTGGAGCCAGGATGG + Intronic
1114250089 14:20952093-20952115 AAATGGGAATAGAGCCCCGATGG - Intergenic
1114801205 14:25777449-25777471 AATAGGGGGTGGAGCCAAGATGG - Intergenic
1115311840 14:31986320-31986342 ACATGAGGGTGGAGCCCTGATGG - Intergenic
1116836574 14:49774198-49774220 GAGTGGGCCAGGAGCCCAGAAGG - Intronic
1117115043 14:52502585-52502607 ACAGGGGGGTGGAGCCAAGATGG + Intronic
1117280271 14:54233874-54233896 AGGAGGGGCTGGAGCCAAGATGG + Intergenic
1118508205 14:66440042-66440064 ACATGTAGTTGGAGCCCAGAAGG - Intergenic
1119298516 14:73552570-73552592 AAATGGGGCCCAAGCTCAGAAGG - Intronic
1119302813 14:73584757-73584779 AAATGGGGCCCAAGCTCAGAAGG - Intergenic
1119533507 14:75380431-75380453 AAAGGGGGTTGGATTCCAGAAGG + Intergenic
1121640486 14:95481769-95481791 AAAGGGAGCTGGTGTCCAGATGG - Intergenic
1122081145 14:99268793-99268815 AAAAGGGGAAGGAGACCAGAGGG - Intronic
1122814714 14:104306791-104306813 AACCTGGGCTGGAGCCCGGAGGG + Intergenic
1122942804 14:104989976-104989998 ACAGAGGCCTGGAGCCCAGAAGG + Intronic
1123033666 14:105463070-105463092 AGAGGGGGCGGGAGGCCAGAGGG - Intronic
1124618017 15:31256545-31256567 AAGTGGGGCTGGAGCCTGGTTGG + Intergenic
1124670311 15:31633254-31633276 ACAGGGGGGTGGAGCCAAGATGG - Intronic
1125530067 15:40407265-40407287 GAATGCAGCTGGAGCACAGAGGG + Intronic
1126682577 15:51217172-51217194 ATTTGGGGCTAGTGCCCAGATGG - Intronic
1126721938 15:51590943-51590965 CAAGGGGGGTGGAGCCAAGATGG + Intronic
1126837422 15:52680303-52680325 ATATGGGGCATGAGCCCAAATGG + Intronic
1127346586 15:58107221-58107243 AAATGGGAAGGGAGCCCTGATGG + Intronic
1128772529 15:70292753-70292775 AAAAGGGGCTGGAGGGCTGAGGG - Intergenic
1129581664 15:76818598-76818620 TAAGGGGGGTGGAGCCAAGATGG + Intronic
1129904836 15:79179192-79179214 AGATGGTGCTGGGGCCCAGCTGG + Intergenic
1130829796 15:87587529-87587551 AGATAGGGGTGGTGCCCAGAAGG + Intergenic
1131543507 15:93296116-93296138 AAGGATGGCTGGAGCCCAGAAGG + Intergenic
1131656239 15:94461840-94461862 AAATAGGGCTGGAATCCTGATGG + Intronic
1132141729 15:99402663-99402685 AAGAGGGGCTGGAGCCCAGTGGG - Intergenic
1133038878 16:3049480-3049502 TACTGGGGATGGAGCCCAGCTGG + Intronic
1133963955 16:10518031-10518053 AGATGAGGCTGGAGCATAGAGGG + Intergenic
1137325962 16:47437707-47437729 AGTTGGGGTTGGAGCCAAGATGG + Intronic
1137800088 16:51255034-51255056 AAGTCGGGGTGGAGCCAAGATGG - Intergenic
1137877791 16:52013743-52013765 ACAGGGGGGTGGAGCCCAGATGG - Intronic
1139256886 16:65551118-65551140 AAAAGTCGCTGGAGCCAAGATGG + Intergenic
1140201975 16:72902373-72902395 AGGTGGGGCTGAGGCCCAGAGGG + Intronic
1140251690 16:73300157-73300179 GACTGAGGCTTGAGCCCAGATGG + Intergenic
1140733374 16:77876218-77876240 AAATAGGGCAGAAGCCCAGGAGG - Intronic
1140887558 16:79258447-79258469 AAATGGGCTTGGACCCCACAAGG - Intergenic
1141472901 16:84251690-84251712 AAATGGGGTTAGAGCAAAGATGG + Intergenic
1142109936 16:88325843-88325865 AGATGGGGCTGCAGGGCAGAAGG + Intergenic
1142194648 16:88733806-88733828 AAGAGGCTCTGGAGCCCAGAGGG + Intronic
1142599744 17:1047847-1047869 CAATGGGGCTGAAGTCCAGGTGG + Intronic
1142675990 17:1513689-1513711 AAAGGGGGCTGGAGATCAGCAGG - Intronic
1143422814 17:6808597-6808619 AAATAGGGGTGGAGCCAAGATGG - Intronic
1144801001 17:17927209-17927231 CAATGGGGGTGGAGTCCAAAGGG + Intronic
1146420887 17:32684254-32684276 AGATGGGGGAGGAGCCAAGATGG - Intronic
1147243518 17:39106015-39106037 AGATGGGTCTGGAGCTCACAGGG - Intronic
1147717249 17:42516690-42516712 AAATGAGGCTCAAGCCCAGGCGG - Intronic
1148567709 17:48643335-48643357 AATTTGGGCTGGAGCGAAGATGG - Intergenic
1148683174 17:49486242-49486264 AACTGCTGCTGGGGCCCAGAGGG - Intergenic
1148887686 17:50785650-50785672 AAATTGGGCAGGAACCCAGAAGG + Intergenic
1148990874 17:51666258-51666280 GGAAGAGGCTGGAGCCCAGAAGG + Intronic
1149993886 17:61397068-61397090 AAATGGGGCGGGAGCGGGGACGG - Intergenic
1151434049 17:74083172-74083194 AAGTGTGGCAGCAGCCCAGATGG + Intergenic
1151589157 17:75032183-75032205 CAATTTGGCTGGAACCCAGAGGG + Intergenic
1152095741 17:78270587-78270609 AAAAGGGGCTGGGGCTCAGGCGG - Intergenic
1152261248 17:79268512-79268534 AACTGTGGCTGGAGCTCAGAGGG - Intronic
1153664749 18:7358878-7358900 AAATGGGAGTGGGGACCAGAAGG + Intergenic
1154287486 18:13073767-13073789 GCATGGGGCTGGAGCCCTCATGG + Intronic
1156235995 18:35205776-35205798 AATTGGGGGAGGAGCCAAGATGG + Intergenic
1157412620 18:47476404-47476426 AAATGTAGGTGTAGCCCAGAGGG - Intergenic
1157904966 18:51561669-51561691 AAGTGGGGCTTGGGCGCAGAAGG - Intergenic
1158835531 18:61327665-61327687 AAAGGTAGGTGGAGCCCAGAGGG - Intergenic
1158900155 18:61954781-61954803 AGATGGGGCTGGAGCAGACATGG + Intergenic
1159061287 18:63517491-63517513 AGATGGGGCTGGAGTGCAGTGGG + Intergenic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1160966750 19:1750009-1750031 GAAGGCGGCTGGAGTCCAGAGGG + Intergenic
1161766042 19:6209506-6209528 AGCTGGAGCTGGAGCACAGAGGG + Intergenic
1162441171 19:10693020-10693042 AAATGAGGCTGGAGGTCAGTGGG + Intergenic
1163861378 19:19744684-19744706 ATGTGGGGCCGGAGCCCAGGTGG + Intergenic
1163974810 19:20841018-20841040 AATAGGGGGTGGAGCCAAGATGG + Intronic
1165010266 19:32840838-32840860 ACATGGTGCTGGAGTCCAGTGGG + Intronic
1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG + Intergenic
1165607271 19:37116464-37116486 AAATATGGGTGGAGCCAAGATGG + Intronic
1165980703 19:39720074-39720096 AATAGGGGGTGGAGCCAAGATGG - Intergenic
1166007749 19:39918682-39918704 AATGAGGGCTGGAGGCCAGATGG - Intronic
1166073402 19:40399375-40399397 AAATGGGGCAGGAGCTCCGGGGG - Intronic
1166219612 19:41355995-41356017 CAGTATGGCTGGAGCCCAGACGG + Intronic
1166336389 19:42110582-42110604 TAAGGAGGCTGGGGCCCAGAGGG - Intronic
1166489692 19:43248087-43248109 AACTGGGGAAGGAGCCAAGATGG - Intronic
1167724566 19:51201397-51201419 AGATGGGGTGGGAGCCCAGCAGG - Intergenic
1167758191 19:51426458-51426480 AGATGGGGTGGGAGCCCAGCAGG + Intergenic
926338934 2:11887585-11887607 AACAGGGGGTGGAGCCAAGATGG - Intergenic
927679018 2:25127927-25127949 CCCTAGGGCTGGAGCCCAGATGG + Intronic
928128408 2:28631632-28631654 ACATGGGGCTGCAGGTCAGATGG - Intronic
928171532 2:29007584-29007606 AGATGGGGATGGAGCGCACAGGG - Intronic
929037292 2:37706373-37706395 AATGGGGGCTGGAACCTAGAGGG + Intronic
929381370 2:41358467-41358489 AAATAGAGGTGGAGCCAAGATGG + Intergenic
929557764 2:42936258-42936280 AATTGGGTCTGGAGCCAGGAAGG - Intergenic
930625355 2:53690865-53690887 AAATGGATCTGGATCCTAGAAGG - Intronic
931210407 2:60189020-60189042 AAAGGGGGGAGGAGCCAAGATGG + Intergenic
931818720 2:65930325-65930347 TCCTGGGGCTGGAGCCAAGATGG - Intergenic
932642184 2:73460449-73460471 AAATTCGGGTGGAGCCAAGATGG + Intronic
932646805 2:73511159-73511181 AAAGGGGGCTGAAGCCAGGAAGG - Intronic
932899155 2:75678091-75678113 AGATGAAGCTGGGGCCCAGAAGG - Intronic
934937691 2:98477216-98477238 AGTTGGGGTTGGAGCCCGGATGG + Intronic
935126008 2:100223525-100223547 AAATGGGGCTGTAGTTCACAGGG - Intergenic
935385790 2:102498955-102498977 AAATGGGGAAGAAGCCCAGGGGG + Intronic
935489520 2:103699006-103699028 AAATGGGGAAGGGGCCAAGATGG - Intergenic
935938198 2:108209249-108209271 AATTGGGGGTGGAGCCAAGATGG - Intergenic
935958817 2:108403779-108403801 ATCAGGGGCTGGAGGCCAGATGG - Intergenic
936716232 2:115190600-115190622 ATCAGGGGCTGGAGGCCAGATGG + Intronic
937049352 2:118875753-118875775 AGAGAGGGCTGGACCCCAGAAGG + Intergenic
937870658 2:126783580-126783602 GAATGGGGCAGTGGCCCAGATGG + Intergenic
938205470 2:129417383-129417405 AAATAGGGGAGGAGCCAAGATGG - Intergenic
938848023 2:135231808-135231830 AACGGGGGATGGAGCCAAGATGG + Intronic
939191739 2:138924586-138924608 ACACGGGCCTGGAGACCAGAAGG - Intergenic
939479188 2:142727863-142727885 ATATTGGGGTGGAGCCAAGATGG + Intergenic
939893598 2:147766519-147766541 CAAGGGGGGTGGAGCCAAGATGG + Intergenic
940095092 2:149965730-149965752 AATTGGGGGTGGAGCCAAGATGG + Intergenic
940586895 2:155663694-155663716 TAATGGGGCTGAAGCCCGGGAGG - Intergenic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941781738 2:169452778-169452800 AAATGGGGGTGGAGCCAAGATGG + Intergenic
942234757 2:173893191-173893213 GGATGTGGCTTGAGCCCAGAAGG - Intergenic
943666825 2:190617749-190617771 AAATGAGGCTTTAGCCCAAAGGG - Intergenic
944030404 2:195228432-195228454 ACATGGGGGAGGAGCCAAGATGG + Intergenic
945483318 2:210366915-210366937 ATCAGGGGCTGGAGGCCAGATGG + Intergenic
945734270 2:213579270-213579292 AAATGGGGCTTGATTCCAAAGGG + Intronic
946305367 2:218854000-218854022 AAATGGGTCTGGAGCTCAGAGGG - Intergenic
948910991 2:241002558-241002580 GAATGGGGCTGGAGTCGAGGAGG + Intronic
1168860523 20:1043208-1043230 AAATGGTGCAGGAACCCAGGAGG - Intergenic
1171168407 20:22993703-22993725 AAAAAGGGGTGGAGCCAAGATGG - Intergenic
1172095953 20:32460604-32460626 AGATGGGGCAGGAGCTCAAAAGG + Intronic
1172625269 20:36343075-36343097 AACTGGGGCTGAGGGCCAGAAGG - Intronic
1172880654 20:38197829-38197851 GAATGGAGCTGGAGCCCCCAGGG - Intergenic
1174056150 20:47799988-47800010 GAGAGGGGCTGGAACCCAGAGGG - Intergenic
1174483804 20:50849005-50849027 AAATGGGGCTGGAGCCCTGCGGG + Intronic
1177137983 21:17327479-17327501 CAATGGGGGAGGAGCCAAGATGG + Intergenic
1178033607 21:28555880-28555902 AAATAGGGCTGAAGCTGAGATGG + Intergenic
1179328319 21:40372981-40373003 AAATGGGGCATTAGCCCAGTAGG + Intronic
1179409824 21:41153984-41154006 CAATGAGGCTGGAGGCCTGAGGG + Intergenic
1180037900 21:45259346-45259368 AAACGGGGCTGGAGTCCAGAGGG - Intergenic
1180642905 22:17313750-17313772 AAATATGGCTGGAGCTCTGAAGG + Intergenic
1181544256 22:23592102-23592124 CAATGGGGCTGGAGCATGGAGGG + Intergenic
1181765927 22:25092252-25092274 AAATTTGGGTGGAGCCCTGAGGG + Intronic
1183097334 22:35560932-35560954 CAATGTAGCTGGAGCACAGAGGG + Intergenic
1184998513 22:48227588-48227610 AAATGGGACTGGAGCCCCTCCGG - Intergenic
1185116910 22:48943013-48943035 AAATGGGTCTGGGGCCCGGGAGG + Intergenic
1185217858 22:49613353-49613375 AGATGGGCTTGGAGCCCTGATGG - Intronic
949717613 3:6951172-6951194 GACTGGGGGTGGAGCCAAGATGG - Intronic
950115095 3:10445640-10445662 AAATGGGGTTTGAGGCCACAGGG - Intronic
950681533 3:14588534-14588556 CAGTGAGGCTGGACCCCAGAAGG - Intergenic
951135839 3:19103329-19103351 AGAGGGGGCAGGAGCCAAGATGG - Intergenic
951770066 3:26245195-26245217 ACATAGGGGTGGAGCCAAGATGG - Intergenic
951862054 3:27263934-27263956 ACATGGGGGTGGAGCCAAGATGG - Intronic
952659272 3:35824674-35824696 TAATGGGGGAGGAGCCAAGATGG - Intergenic
952694221 3:36247119-36247141 ACATCTGGTTGGAGCCCAGAAGG - Intergenic
953130552 3:40133892-40133914 ACAAGGGGGTGGAGCCAAGATGG + Intronic
954072993 3:48156842-48156864 ATATTGGGCTGAAGCACAGAGGG - Intergenic
954287095 3:49626761-49626783 CAAGGGAGCTGGAACCCAGAGGG - Intronic
954631689 3:52051187-52051209 AGGTGGGGCTGGGGCACAGAGGG + Intronic
955030172 3:55209128-55209150 AAATGGAGGTGGAGCCAAGATGG + Intergenic
955563861 3:60223364-60223386 GAATGGATCTGGTGCCCAGATGG - Intronic
955669697 3:61391099-61391121 ACTTGGGGGTGGAGCCAAGATGG + Intergenic
956297141 3:67727205-67727227 AAAGGAGGGTGGAGCCAAGATGG - Intergenic
956866549 3:73374597-73374619 AACTGGGGGAGGAGCCAAGATGG - Intergenic
957061964 3:75489594-75489616 TAACGGGGGTGGAGCCAAGATGG - Intergenic
957668100 3:83262699-83262721 AACTGGTCCTGGAGCCCAAAAGG + Intergenic
958252867 3:91291024-91291046 ATAGGGGGGTGGAGCCAAGATGG + Intergenic
958255554 3:91320745-91320767 ATATGAGGGTGGAGCCAAGATGG - Intergenic
960142888 3:114167997-114168019 AAATGGAGCTGGTGCCCTGATGG + Intronic
960224099 3:115148633-115148655 AAATGAGGCTGAAGTCCAGCAGG + Intergenic
960454982 3:117860066-117860088 ATATGGGTCTGGAGCACAGCGGG - Intergenic
960545836 3:118914239-118914261 AAATCGGGGAGGAGCCAAGATGG + Intronic
960747129 3:120902335-120902357 TAAGGGGGGTGGAGCCAAGATGG - Intergenic
961291437 3:125849807-125849829 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
961811901 3:129526898-129526920 GTAGGGGGCTGGAGCCCAGGTGG + Intergenic
961871278 3:129990085-129990107 AAATGGGTCTGGAGGGCAAATGG + Intergenic
962456655 3:135571090-135571112 AACTGGGGTTTGAGCCCAGGTGG - Intergenic
962761317 3:138517693-138517715 AAATAGGGGTGGAGCCAAGATGG + Intronic
963303090 3:143620627-143620649 ACAGGGGGGTGGAGCCAAGATGG + Intronic
963678671 3:148347269-148347291 AGAGGGGGGTGGAGCCAAGATGG + Intergenic
963844217 3:150139179-150139201 ATATGGATCTGGAGCTCAGAAGG + Intergenic
964117592 3:153152738-153152760 AAAAGGAGCTGGAGCCAAGAAGG - Intergenic
964463632 3:156966139-156966161 TGATGGGGGTGGAGCCAAGATGG + Intronic
964532656 3:157685202-157685224 AGAAGGGGGTGGAGCCAAGATGG + Intergenic
964624982 3:158750066-158750088 AACTGGAGCATGAGCCCAGAGGG - Intronic
965293198 3:166909868-166909890 AAAGGGGGCTGAAGCCAGGAGGG - Intergenic
966807696 3:183819525-183819547 ACCCGGGGCTGGAGCCCAGATGG + Intronic
966896677 3:184450223-184450245 ACTTGGGGCTGGTTCCCAGACGG - Intronic
967535921 3:190603278-190603300 AAATGGGTATGCAGCTCAGAAGG + Intronic
967955258 3:194872812-194872834 GAATGTGGCAAGAGCCCAGAGGG - Intergenic
969005858 4:4019685-4019707 TAGTGGGGGTGGAGCCAAGATGG - Intergenic
969188366 4:5496686-5496708 AAATGGGCCTGGGGCCAAGATGG - Intronic
969747034 4:9080575-9080597 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
969807091 4:9617605-9617627 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
970623186 4:17848536-17848558 AGACAGGGCTGGAGCCAAGATGG + Intronic
970828113 4:20302745-20302767 AAATGGGGCTTGATTCTAGAAGG + Intronic
971899506 4:32640848-32640870 AGGTGGGGCTTGAGCCCAGGAGG - Intergenic
973611171 4:52637172-52637194 AAGTGAGGGTAGAGCCCAGAAGG - Intronic
973800720 4:54475117-54475139 AAAAGGGGCTGTAGAACAGAGGG + Intergenic
974403413 4:61433723-61433745 ATATGAGTCTGGAGCTCAGAAGG - Intronic
974419041 4:61647286-61647308 AAATCGGGGAGGAGCCAAGATGG - Intronic
974425939 4:61743718-61743740 GACAGGGGCTGGAGCCAAGATGG + Intronic
974917236 4:68194055-68194077 AAGTGAGGGTGGAGCCAAGATGG + Intergenic
975092889 4:70424039-70424061 ATTTGGGGGTGGAGCCAAGATGG - Intergenic
975165608 4:71175203-71175225 AAGTGGGGGTGGAGCCAAGATGG + Intergenic
975277715 4:72520976-72520998 AAAGTGGGGAGGAGCCCAGATGG - Intronic
976288965 4:83397902-83397924 AAATAGGGGTAGAGCCAAGATGG + Intergenic
976433141 4:84987203-84987225 AATAGGGGGTGGAGCCAAGATGG + Intergenic
976592087 4:86859320-86859342 AAATGGCCCTGCTGCCCAGAAGG + Intergenic
977283960 4:95078845-95078867 AAAGATGGCTGGAGCCCAGGAGG - Intronic
978143850 4:105348687-105348709 AAAGCGGACTGGATCCCAGAAGG + Intergenic
979317370 4:119280109-119280131 AAACGGGGGAGGAGCCAAGATGG - Intronic
981407718 4:144391550-144391572 AAGCTGGGCTGGAGCCAAGATGG + Intergenic
981423242 4:144575365-144575387 AAGTGAGGCTGGAGCCCAGGAGG + Intergenic
981448932 4:144873174-144873196 AAATGGAACTGGAGCTCAGGTGG + Intergenic
982458205 4:155635568-155635590 AAGTGGGGCTGGGACCCAGGAGG + Intergenic
983147953 4:164241610-164241632 AAATGGGGGAGGAGCCAAGATGG + Intronic
983495862 4:168441986-168442008 ATATGGGGGAGGAGCCAAGATGG + Intronic
984696499 4:182785062-182785084 ATATGGGGGAGGAGCCAAGATGG - Intronic
984910339 4:184668468-184668490 AGATGAGGCTGGAGCACAGCGGG - Intronic
986132841 5:4946790-4946812 CAATGAGGCTAGATCCCAGAAGG - Intergenic
988371627 5:30376873-30376895 AAATGGGGCTGCTTTCCAGAAGG + Intergenic
988451950 5:31352325-31352347 AGATGGGGCTGGAATCCAGCAGG - Intergenic
988646643 5:33102030-33102052 AAAGTGGGGTGGAGCCAAGACGG - Intergenic
988792307 5:34619997-34620019 AACTCTGGTTGGAGCCCAGAGGG + Intergenic
988829096 5:34970477-34970499 AAATGGAACTGGAGCCCCCATGG - Intergenic
989677504 5:43988865-43988887 AAATGGGGATGGAGCACAAGGGG + Intergenic
990708646 5:58558265-58558287 AAAGGGGGGAGGAGCCAAGACGG - Intergenic
990710245 5:58572789-58572811 ATATCGGGGTGGAGCCAAGATGG + Intergenic
992328917 5:75695695-75695717 AAGTGGGGGAGGAGCCAAGATGG + Intronic
993132405 5:83915205-83915227 AGATTGGGCTTGAGCCCAGGTGG + Intergenic
994664345 5:102689555-102689577 AAAAGGTGGTGGAGCCAAGATGG - Intergenic
996013136 5:118502894-118502916 AAATGGGGGTGGAGCCAAGATGG - Intergenic
996935515 5:128943737-128943759 AACTGGGGGTGGAGCCAAGATGG - Intronic
997112127 5:131087151-131087173 TAACGGGGGTGGAGCCAAGATGG + Intergenic
997361601 5:133298842-133298864 AACCGGGGCTGGAGACCAGGAGG + Intronic
998205760 5:140155820-140155842 ACATGGGGTTGGAGCACAGGGGG - Intergenic
999967571 5:156826036-156826058 AAAGGAGGCTGGCTCCCAGAAGG + Intergenic
1000108738 5:158086680-158086702 AAACAGAGCTGGAGCCCTGATGG + Intergenic
1001929672 5:175664022-175664044 AAGTGTGGCTGGAGCCAAGTTGG + Intronic
1001987167 5:176084300-176084322 AATAGGGGGTGGAGCCAAGATGG - Intronic
1002229701 5:177753847-177753869 AATAGGGGGTGGAGCCAAGATGG + Intronic
1002265644 5:178029930-178029952 AATAGGGGGTGGAGCCAAGATGG - Intronic
1002581624 5:180212406-180212428 AAAAGAGGCTGGAGCCAAGGTGG + Intergenic
1002661973 5:180797427-180797449 AAAGGGGGGGGGGGCCCAGAGGG + Intronic
1003146547 6:3514884-3514906 AGCTGGGGCTGCAGACCAGAGGG + Intergenic
1003200946 6:3959783-3959805 CAATGGGACTGGAGCCCCCAGGG + Intergenic
1003388598 6:5692318-5692340 GAAGGGGGGTGGAGCCAAGATGG - Intronic
1003869300 6:10389604-10389626 AAATGGGCCTAGCACCCAGAAGG - Intergenic
1004478412 6:15996127-15996149 TCATGGGCCTGGAGACCAGAAGG + Intergenic
1004832737 6:19495139-19495161 AAAGGAGGGTGGAGCCAAGATGG + Intergenic
1005202761 6:23365101-23365123 ACATGTGGGTGGAGCCAAGATGG - Intergenic
1005485305 6:26293829-26293851 AAATGGGGCTGTGGCCTGGATGG + Intergenic
1006278051 6:33022044-33022066 AAGTGGCGCTGGAACCCTGAGGG + Intergenic
1006831215 6:36969390-36969412 AAATGGGGCAGTGGCCCGGAGGG - Intronic
1006897258 6:37479113-37479135 AAGAGGGGATGAAGCCCAGAAGG - Intronic
1007155215 6:39736402-39736424 TAGTGGGGGTGGAGCCAAGATGG + Intergenic
1007177097 6:39904383-39904405 AGAAGGGGCTGGTGCCCAGTCGG + Exonic
1007210000 6:40185759-40185781 AGAAGGGGCTGGAGCCCAGGAGG + Intergenic
1007577171 6:42932670-42932692 AAGAGGGGAGGGAGCCCAGATGG + Intronic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1008874202 6:56307853-56307875 AAGAGGGGGTGGAGCCAAGATGG - Intronic
1008999795 6:57700424-57700446 ATATGAGGGTGGAGCCAAGATGG + Intergenic
1009188276 6:60599846-60599868 ATATGAGGGTGGAGCCAAGATGG + Intergenic
1010318939 6:74484527-74484549 AAATCGGGGAGGAGCCAAGATGG + Intergenic
1010353450 6:74903758-74903780 ATCTGGGGGTGGAGCCAAGATGG + Intergenic
1010482860 6:76375574-76375596 AAGATGGGCTGGAGCCAAGATGG - Intergenic
1010540819 6:77089905-77089927 AGATGGGGCTGGAGAGCAAAGGG - Intergenic
1010950535 6:82031781-82031803 AAATAGGTCAGGAGACCAGATGG + Intergenic
1011514288 6:88135545-88135567 AAAGGGGGCAGGAGGGCAGAGGG + Intergenic
1012247526 6:96942367-96942389 AAATGGGTATTGAGCACAGATGG - Intronic
1012821915 6:104095441-104095463 AAGCGGGGGTGGAGCCAAGATGG + Intergenic
1012844638 6:104374604-104374626 AAGGGGGGGTGGAGCCAAGATGG + Intergenic
1012952385 6:105532263-105532285 CAATTTGGCTGGAGCTCAGAGGG + Intergenic
1016018410 6:139210492-139210514 AAATGTGGGTGGAGCCAAGATGG + Intergenic
1016233977 6:141839086-141839108 ACATGGGGCTGGAGGCAAGAGGG + Intergenic
1016243581 6:141958373-141958395 AAATGGGGATGTGGCCCAGCTGG + Intergenic
1017653475 6:156604695-156604717 GAATAGGGTTGGAGCCAAGATGG + Intergenic
1018415574 6:163599684-163599706 AAATGAGGCAGGAGACCAGCAGG + Intergenic
1018686721 6:166308810-166308832 AAAGCGGGCTGGAGCTGAGAGGG + Intergenic
1018867831 6:167759403-167759425 GGACGGAGCTGGAGCCCAGATGG + Intergenic
1019328910 7:453113-453135 AAGAGGGGCTGGGGCCCAGGTGG + Intergenic
1019377348 7:699908-699930 AAATGGAGCTCGAGGCCCGATGG + Intronic
1019925635 7:4190494-4190516 AACACGAGCTGGAGCCCAGAGGG - Intronic
1020525155 7:9250558-9250580 AAAGGGGGCCGGGGCCAAGATGG + Intergenic
1020538901 7:9436389-9436411 TCATGGGGGTGGAGCCAAGATGG + Intergenic
1020952998 7:14704476-14704498 AAAAGGGGGAGGAGCCAAGATGG + Intronic
1021047344 7:15940226-15940248 AATTGGGGGAGGAGCCAAGATGG + Intergenic
1021156299 7:17215214-17215236 AAGCGGGGGTGGAGCCAAGATGG + Intergenic
1021661538 7:22924193-22924215 AAAGGGGGGTGGAGCCAAGATGG + Intergenic
1022555614 7:31292341-31292363 GAATGGGGCTGGTTCCCAGCAGG - Intergenic
1022765690 7:33408572-33408594 AAATGTGGGAGGAGCCAAGATGG - Intronic
1022846006 7:34210372-34210394 AAATGGGGCTGGTGCACATTGGG + Intergenic
1023084754 7:36559110-36559132 AAATGTGGGAGGAGCCAAGATGG - Intronic
1024261327 7:47576265-47576287 CACTGGGCCTGGAGCCCAAAAGG + Intronic
1024459965 7:49649735-49649757 ACAGGGGGGTGGAGCCAAGATGG + Intergenic
1025236848 7:57240166-57240188 GAGAGGGGCTGGAACCCAGAGGG + Intergenic
1027965050 7:84993573-84993595 AGTTGGGGGTGGAGCCAAGATGG - Intergenic
1028294274 7:89108032-89108054 AAAGGGGGCTGAACCACAGAGGG + Intronic
1030392437 7:108943667-108943689 AATAGGGGGTGGAGCCAAGATGG - Intergenic
1030396759 7:108995592-108995614 AAATGAGGCAGGAGACAAGAGGG + Intergenic
1030724946 7:112916449-112916471 AGAGGGGGTTGGAGCCAAGATGG + Intronic
1031352614 7:120753617-120753639 AAATGGGGGTGGGACACAGAGGG + Intergenic
1033226802 7:139569043-139569065 AGATGTGGCCGGAGCCCAGTGGG + Exonic
1033332189 7:140426084-140426106 GAACGGGGCTGGAGTCCAGGGGG - Exonic
1033381970 7:140830384-140830406 AACTGGGGTTGGAGGCCAAAGGG - Intronic
1033587876 7:142787716-142787738 AAAAGGGGCTGGAATCCAGACGG + Intergenic
1034125590 7:148668701-148668723 AATGAGAGCTGGAGCCCAGATGG + Intergenic
1035229384 7:157454528-157454550 AAACAGGGGTGGAGCCAAGATGG - Intergenic
1035247641 7:157574609-157574631 AAATATTTCTGGAGCCCAGAGGG - Intronic
1035756110 8:2034211-2034233 AGGTGGGGCCAGAGCCCAGATGG - Intergenic
1036263546 8:7258095-7258117 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036264847 8:7265717-7265739 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036266148 8:7273339-7273361 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036267449 8:7280961-7280983 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036268751 8:7288583-7288605 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036270055 8:7296205-7296227 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036297841 8:7550850-7550872 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036299145 8:7558498-7558520 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036300450 8:7566148-7566170 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036301753 8:7573792-7573814 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036303050 8:7581441-7581463 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036315587 8:7716634-7716656 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036316895 8:7724282-7724304 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036318202 8:7731930-7731952 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036319511 8:7739578-7739600 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036320818 8:7747225-7747247 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036322128 8:7754873-7754895 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036323437 8:7762521-7762543 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036324732 8:7770168-7770190 GAATGGGGCTGGGCCCCAGACGG + Intergenic
1036351302 8:8014139-8014161 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036352607 8:8021785-8021807 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036353899 8:8029433-8029455 GAATGGGGCTGGGCCCCAGACGG - Intergenic
1036536123 8:9654757-9654779 ACTTGGGGGTGGAGCCAAGATGG + Intronic
1036745779 8:11408090-11408112 AGCTGGGGGTGGAGCCAAGATGG - Intronic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1038234280 8:25736336-25736358 AAAGGGGGGAGGAGCCAAGATGG - Intergenic
1038366533 8:26941070-26941092 AAATCGGGGTGGAGCCAAGATGG - Intergenic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039719245 8:40144327-40144349 AAAGTGGGGTGGAGCCAAGATGG - Intergenic
1039869922 8:41537364-41537386 AACTTGGGCTGGGGCCCAGGAGG + Intronic
1040614300 8:49018975-49018997 AGATGGGGCTGGGGCAGAGATGG - Intergenic
1041613263 8:59875809-59875831 AAAGGGGGGAGGAGCCAAGATGG - Intergenic
1041999180 8:64102225-64102247 ATTTGGGGGTGGAGCCAAGATGG + Intergenic
1042318785 8:67452905-67452927 CAATGTGGCTGGAGCCAAGTGGG + Intronic
1044037834 8:87327811-87327833 AAAAGGGGGAGGAGCCAAGATGG - Intronic
1044224917 8:89708180-89708202 GAAAGGGGGTGGAGCCAAGATGG + Intergenic
1044973851 8:97644622-97644644 ACCTGGGGCTGGAGCCGAAACGG + Exonic
1045088143 8:98710152-98710174 AAATAGGGATGGAGACAAGACGG + Intronic
1045326074 8:101118780-101118802 CCTTGGAGCTGGAGCCCAGAGGG + Intergenic
1045360201 8:101425776-101425798 AAAAAGGGGTGGAGCCAAGATGG + Intergenic
1045385958 8:101671030-101671052 CAAGGGGGGTGGAGCCAAGATGG + Intergenic
1045499581 8:102734869-102734891 GAAGGCAGCTGGAGCCCAGAGGG + Intergenic
1045708673 8:104957891-104957913 AAATGCGGCTGCTACCCAGAGGG - Intronic
1045843032 8:106601522-106601544 AAATGGGGGTGGAACCCATGAGG - Intronic
1046064702 8:109182506-109182528 AAATTGGGCTGGAACCAAGGAGG + Intergenic
1047464564 8:125099822-125099844 AAATGGGGCTGGTAACCAGAGGG + Intronic
1048053354 8:130840224-130840246 AAATGAGGCTGGGGTTCAGAAGG + Intronic
1048093071 8:131262091-131262113 TAAGGGGGGTGGAGCCAAGATGG + Intergenic
1048258713 8:132926456-132926478 TAATGAGGTTAGAGCCCAGAGGG - Intronic
1048868353 8:138777111-138777133 AAAAGGGAGTGGAGCCCACAGGG - Intronic
1049291546 8:141805605-141805627 ACATGGACCTGGAGTCCAGATGG + Intergenic
1049422061 8:142521394-142521416 GGATGGGGCTGGAGACCACAGGG - Intronic
1050179061 9:2900213-2900235 AAATTTGGGTGGAGCCAAGATGG - Intergenic
1050370983 9:4921173-4921195 AAATAGAGGTGGAGCCAAGATGG - Intergenic
1050399047 9:5231414-5231436 AAAGCAGTCTGGAGCCCAGAAGG + Exonic
1050879061 9:10676108-10676130 AATTGAGGATGGAGCCAAGATGG - Intergenic
1050993722 9:12186483-12186505 AAAAGGAGCTGGAGCACACAGGG - Intergenic
1051082162 9:13306669-13306691 GGATGGGGGTGGAGCCAAGATGG - Intergenic
1051511562 9:17884532-17884554 TAATGCAACTGGAGCCCAGAGGG + Intergenic
1052657440 9:31380718-31380740 AAATGGGCATGGTGCACAGATGG + Intergenic
1052724970 9:32217961-32217983 ATAGGGGGGTGGAGCCAAGATGG - Intergenic
1053121891 9:35553699-35553721 AAGTGTGGCTGGAGCACAGTGGG + Intronic
1055578987 9:77688372-77688394 ACAGGGGGGTGGAGCCAAGATGG - Intergenic
1055764982 9:79652656-79652678 GCAGGGGGCTGGAGCCCTGAAGG - Exonic
1057086365 9:92214405-92214427 AATTGGGGGAGGAGCCAAGATGG + Intronic
1058457737 9:105153529-105153551 TAATAGGGCTGGACCCCAGAAGG - Intergenic
1060542562 9:124440757-124440779 AAATCCTGCTGGAGCCCAGAGGG + Intergenic
1060954250 9:127626911-127626933 TCAGGGGGCTTGAGCCCAGAAGG - Intronic
1061550457 9:131331527-131331549 AAATGGGGCCTCAGCGCAGAAGG - Intergenic
1061955947 9:133961430-133961452 ATCTGGGGCTGCAGACCAGAGGG + Intronic
1186631139 X:11350119-11350141 AAAGGGAACTGGAGCCCAGAGGG - Intronic
1187471948 X:19577531-19577553 AGATGGGGCTCGTGCACAGACGG + Intronic
1187602248 X:20845440-20845462 GGATGGGGGTGGAGCCAAGATGG + Intergenic
1188036142 X:25319060-25319082 AACTGGGGGTGGAGCCAAGATGG - Intergenic
1188502453 X:30842734-30842756 AAAGATCGCTGGAGCCCAGAAGG + Intronic
1189348815 X:40262176-40262198 AAATTGAGCTGAGGCCCAGAAGG - Intergenic
1189603379 X:42650738-42650760 AACTGAGGGTGGAGCCAAGATGG + Intergenic
1190602931 X:52111119-52111141 TAAGGGGGGTGGAGCCAAGATGG + Intergenic
1190720676 X:53145014-53145036 AATTTGGGGTGGAGCCAAGATGG + Intergenic
1190807723 X:53854551-53854573 AACTGGGGGTGAAGCCAAGATGG - Intergenic
1191065332 X:56341771-56341793 AACCGGGGTTGGAGCCAAGATGG - Intergenic
1191273407 X:58510359-58510381 ACAGGGGGTTGGAGCCAAGATGG + Intergenic
1191567182 X:62555433-62555455 ACAGGGGGTTGGAGCCAAGATGG + Intergenic
1191701425 X:64046927-64046949 AAATGGGGTAGGGGCCAAGATGG + Intergenic
1192096408 X:68216911-68216933 AAATTGGGGAGGAGCCAAGATGG + Intronic
1192150427 X:68708915-68708937 ACCTGGGGCTGAAGCCCAGGTGG - Intronic
1192390104 X:70716910-70716932 AATTGGAGGTGGAGCCAAGATGG - Intronic
1192667159 X:73100065-73100087 ATGGGGGGCTGGAGCCAAGATGG - Intergenic
1193324011 X:80157441-80157463 TTATAGGGCTGGAGCCAAGATGG - Intergenic
1194998916 X:100623083-100623105 AGATGGGGCTGAGGCCAAGAAGG + Intergenic
1195107922 X:101617934-101617956 ATAGGGGGCTGGTACCCAGACGG + Exonic
1195126156 X:101811820-101811842 AAACGGAGGTGGAGCCAAGATGG - Intergenic
1195912380 X:109901610-109901632 AATAGGGGGTGGAGCCAAGATGG - Intergenic
1196380772 X:115086593-115086615 TATTGGGGGTGGAGCCAAGAAGG - Intergenic
1197114529 X:122817518-122817540 AGCTGGGGCCCGAGCCCAGATGG - Intergenic
1197680539 X:129378807-129378829 AATTGGGGATGGAGAGCAGAGGG + Intergenic
1198485262 X:137080858-137080880 AAACGGAGCTCGAGCCAAGATGG - Intergenic
1200318843 X:155163316-155163338 AAAGAGGGGTGGAGCCAAGATGG - Intergenic
1201245922 Y:12003574-12003596 AAATGGGGGTGGAGCCAAGATGG - Intergenic
1201289244 Y:12406762-12406784 AGATGTGGCTTGTGCCCAGATGG - Intergenic
1201437289 Y:13972665-13972687 AAATCGGGGAGGAGCCAAGATGG - Intergenic
1201645365 Y:16223985-16224007 ATATGGGGGTGGAGCCAAGATGG - Intergenic
1201657448 Y:16361337-16361359 ATATGGGGGTGGAGCCAAGATGG + Intergenic
1202064702 Y:20925990-20926012 GAAAGGGGGTGGAGCCAAGATGG - Intergenic
1202361574 Y:24115717-24115739 GAACGGGGGTGGAGCCAAGATGG - Intergenic
1202363499 Y:24137383-24137405 GAACGGGGGTGGAGCCAAGATGG + Intergenic
1202507281 Y:25532734-25532756 GAACGGGGGTGGAGCCAAGATGG - Intergenic
1202509204 Y:25554402-25554424 GAACGGGGGTGGAGCCAAGATGG + Intergenic