ID: 915907249

View in Genome Browser
Species Human (GRCh38)
Location 1:159887889-159887911
Sequence GGCTCTCTGCAGGAGGTTCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 226}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915907239_915907249 14 Left 915907239 1:159887852-159887874 CCTTGAGCTCCTCCTCCTGCTCC 0: 1
1: 0
2: 20
3: 243
4: 2101
Right 915907249 1:159887889-159887911 GGCTCTCTGCAGGAGGTTCTGGG 0: 1
1: 0
2: 0
3: 26
4: 226
915907240_915907249 5 Left 915907240 1:159887861-159887883 CCTCCTCCTGCTCCATCCGCAGC 0: 1
1: 3
2: 10
3: 106
4: 887
Right 915907249 1:159887889-159887911 GGCTCTCTGCAGGAGGTTCTGGG 0: 1
1: 0
2: 0
3: 26
4: 226
915907244_915907249 -7 Left 915907244 1:159887873-159887895 CCATCCGCAGCTTGTTGGCTCTC 0: 1
1: 0
2: 2
3: 11
4: 138
Right 915907249 1:159887889-159887911 GGCTCTCTGCAGGAGGTTCTGGG 0: 1
1: 0
2: 0
3: 26
4: 226
915907241_915907249 2 Left 915907241 1:159887864-159887886 CCTCCTGCTCCATCCGCAGCTTG 0: 1
1: 0
2: 3
3: 27
4: 282
Right 915907249 1:159887889-159887911 GGCTCTCTGCAGGAGGTTCTGGG 0: 1
1: 0
2: 0
3: 26
4: 226
915907242_915907249 -1 Left 915907242 1:159887867-159887889 CCTGCTCCATCCGCAGCTTGTTG 0: 1
1: 0
2: 0
3: 15
4: 160
Right 915907249 1:159887889-159887911 GGCTCTCTGCAGGAGGTTCTGGG 0: 1
1: 0
2: 0
3: 26
4: 226
915907238_915907249 26 Left 915907238 1:159887840-159887862 CCTTGCTCATGTCCTTGAGCTCC 0: 1
1: 0
2: 3
3: 20
4: 333
Right 915907249 1:159887889-159887911 GGCTCTCTGCAGGAGGTTCTGGG 0: 1
1: 0
2: 0
3: 26
4: 226
915907236_915907249 30 Left 915907236 1:159887836-159887858 CCCACCTTGCTCATGTCCTTGAG 0: 1
1: 0
2: 3
3: 19
4: 146
Right 915907249 1:159887889-159887911 GGCTCTCTGCAGGAGGTTCTGGG 0: 1
1: 0
2: 0
3: 26
4: 226
915907237_915907249 29 Left 915907237 1:159887837-159887859 CCACCTTGCTCATGTCCTTGAGC 0: 1
1: 0
2: 2
3: 14
4: 209
Right 915907249 1:159887889-159887911 GGCTCTCTGCAGGAGGTTCTGGG 0: 1
1: 0
2: 0
3: 26
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915907249 Original CRISPR GGCTCTCTGCAGGAGGTTCT GGG Exonic
905365598 1:37449632-37449654 GTCTCCCTGCAGGAGGCTCTGGG - Intergenic
906099930 1:43253705-43253727 GCCTCTGTGCAGGCGGATCTGGG + Intronic
907453184 1:54560268-54560290 GGCTCCCTGGAGGAGGTGATGGG + Intronic
908877859 1:68698331-68698353 GCCTCTCCGCAAGAGGCTCTGGG + Intergenic
911774673 1:101793117-101793139 TTCTGTCTGCAGGATGTTCTGGG + Intergenic
912687666 1:111779769-111779791 CGCTGTCTGCAGGAGGATGTAGG + Intronic
913489859 1:119368818-119368840 GGCTCACTGCCGGAGGTGTTAGG - Exonic
915788615 1:158643386-158643408 GGCTCTCAGCAAAATGTTCTAGG + Exonic
915907249 1:159887889-159887911 GGCTCTCTGCAGGAGGTTCTGGG + Exonic
916825488 1:168438181-168438203 GGCTTTCTGTAGCAGGTCCTAGG - Intergenic
918099817 1:181363725-181363747 GGCTCTCTGCATGATGATGTGGG + Intergenic
918145364 1:181751397-181751419 GGCTCTCTGCAGCCTGTGCTAGG + Intronic
921172155 1:212559318-212559340 GGCTTCCAGGAGGAGGTTCTGGG - Intergenic
923668672 1:236021250-236021272 GGCTCTTTGCAGGAAATACTGGG + Intronic
923790636 1:237108210-237108232 GCCCCTCTCCTGGAGGTTCTGGG - Intronic
1066711007 10:38233763-38233785 GGCCCTCAGCAGGATGCTCTGGG + Intergenic
1067196786 10:44126713-44126735 AGCTCTCTGCAGGAGTCACTAGG + Intergenic
1067302309 10:45023131-45023153 GGCTCTCATCAGGAGGCTCTGGG + Intergenic
1067450616 10:46379929-46379951 GGGTCTCTGCATCAGGGTCTGGG - Exonic
1067586627 10:47479822-47479844 GGGTCTCTGCATCAGGGTCTGGG + Exonic
1069038471 10:63670019-63670041 GAATCTCTGAAGGAGGTTCCAGG - Intergenic
1070779213 10:79127746-79127768 GGCCCTTTGCAGGAGCTGCTGGG + Intronic
1071551123 10:86566937-86566959 GGATCTCTGGGGGAGGTCCTTGG + Intergenic
1072497493 10:95976556-95976578 GGCTCTGAGCAGTAGGTTCTAGG + Intronic
1073276886 10:102319557-102319579 GGCTCTGAGAAGGAGTTTCTAGG - Intronic
1073443013 10:103564054-103564076 GGGTCTCTGCCAGTGGTTCTGGG + Intronic
1073443112 10:103564487-103564509 GGCTGTGTGCAGGAGGGGCTGGG - Intronic
1076000551 10:126909319-126909341 GGCTCTTAGCAGGAGGCCCTGGG - Intronic
1077209130 11:1360288-1360310 GGCTCTCTGCTGTTGGTTGTTGG + Intergenic
1077228108 11:1447122-1447144 GGCCCTGGGAAGGAGGTTCTGGG - Intronic
1080505825 11:32912386-32912408 GGATTTCTGCAGTAGGATCTTGG + Intronic
1080569645 11:33544282-33544304 AGCACTCTGGAGGAGGTCCTGGG - Exonic
1083333386 11:61909440-61909462 GGCTCCTTGCAGGAGTCTCTGGG - Intronic
1083765749 11:64840643-64840665 GGCTGTCTGCAGCAGGTTTGGGG + Exonic
1084550376 11:69837894-69837916 GGCTGTCTGCAGGAGGTTGGAGG + Intergenic
1087836674 11:102881988-102882010 GACTCTCTGCTGGAGGTCTTGGG + Intergenic
1088703723 11:112440838-112440860 GACTGTCTTCTGGAGGTTCTTGG - Intergenic
1088751489 11:112845780-112845802 GTGTCTCTGCAGGTGTTTCTGGG + Intergenic
1089104421 11:115990314-115990336 GGCGCTCTGCTGGAGCTCCTTGG + Intergenic
1089665722 11:120017366-120017388 GGCTCTGTGCTGGAGGTGCGTGG - Intergenic
1090094366 11:123729173-123729195 TCCTCTCTGCAGGAAGGTCTGGG + Exonic
1090562158 11:127943933-127943955 GGCTCAGTGGAGGAGGTTGTGGG - Intergenic
1091015579 11:132048292-132048314 CTCTCTTTGCAGGAGGCTCTTGG - Intronic
1091622399 12:2099288-2099310 GGTTCTCTGCAGAAGGATCTAGG - Intronic
1092151106 12:6249333-6249355 TGGTATCTGCAGGAGGATCTGGG - Intergenic
1092239645 12:6828907-6828929 GGCCCTCTGCAGGTAGTTGTAGG - Exonic
1096768013 12:53910144-53910166 GGGTATCTGAAGGAAGTTCTAGG + Intergenic
1097719244 12:63002502-63002524 GCCTCTCTGCTGGAGGCTCCCGG + Intergenic
1098399173 12:70054793-70054815 TGCTCTCTGGAGGAGCTTCCTGG + Intergenic
1103012242 12:117466292-117466314 GGCTCTGGGCAGGGAGTTCTAGG - Exonic
1104498045 12:129259214-129259236 CACTCACTGCAGGAGGATCTAGG + Intronic
1106844619 13:33725011-33725033 AGCTTTCTGCAGGATTTTCTGGG - Intergenic
1108534726 13:51362984-51363006 GGCTCTCTGCCGCCTGTTCTGGG - Intronic
1109860610 13:68192995-68193017 GGGTCTCTCCATGAGGTTATAGG + Intergenic
1113124070 13:106957190-106957212 GGCTCTCCACAGGTGTTTCTGGG + Intergenic
1118608925 14:67524520-67524542 GTCGGACTGCAGGAGGTTCTGGG - Intronic
1119261515 14:73240734-73240756 GGCTCTCTGGAGAAGGTCCCTGG + Intronic
1120013223 14:79441250-79441272 GGATCTCTGTAGCAAGTTCTTGG + Intronic
1120386409 14:83852450-83852472 GGCTCTCTGTAGGAGCTCCGGGG + Intergenic
1120644267 14:87054371-87054393 GGCTATCTGCTGGAGATTCAGGG + Intergenic
1122314543 14:100818002-100818024 GGCTCTCTGCAGGAGGAGGGAGG + Intergenic
1122394845 14:101417477-101417499 GGTTATCTGCAGGAAGGTCTAGG - Intergenic
1123150892 14:106180785-106180807 GTCTATCTGGAGAAGGTTCTGGG + Intergenic
1123161137 14:106278842-106278864 GTCTGTCTGGAGGAAGTTCTGGG + Intergenic
1123202999 14:106684614-106684636 GTCTGTCTGGAGAAGGTTCTGGG + Intergenic
1123399310 15:19968642-19968664 GTCTATCTGGAGAAGGTTCTGGG + Intergenic
1124017799 15:25892622-25892644 GCCTCTCTGCTTGAGGTGCTGGG - Intergenic
1124141585 15:27081729-27081751 GGCTCTCAGCCGCTGGTTCTGGG - Intronic
1124802690 15:32849570-32849592 CGCTCTTTGCAGGAATTTCTGGG + Intronic
1126696618 15:51331264-51331286 GCCTCTCTGCAGGAAGGCCTCGG - Intronic
1128636429 15:69305438-69305460 GGCTCTCAGCATGAGGTCCAAGG - Intronic
1128704314 15:69827664-69827686 GGCACTCTGAAGGGGGTCCTCGG + Intergenic
1130254174 15:82318226-82318248 GGCACTCAGCAGGAGGGGCTTGG + Intergenic
1130600797 15:85271745-85271767 GGCACTCAGCAGGAGGGGCTTGG - Intergenic
1131140288 15:89971728-89971750 CGCTCTCTGCTGGAGGATCCCGG + Intergenic
1132130611 15:99275202-99275224 TTCTCTCTGCTGGAGGTACTGGG - Intronic
1133235208 16:4384467-4384489 GGCTCACTCCAGCATGTTCTGGG - Intronic
1133723847 16:8519504-8519526 TGCTCAGTGCAGGTGGTTCTTGG + Intergenic
1134086340 16:11359969-11359991 AGCTCTCTTCAGGAGGCTCTGGG + Intronic
1134199281 16:12184478-12184500 GGCTACCAGCAGGAGGCTCTAGG - Intronic
1141096742 16:81168327-81168349 GGCACTGTGCAGGGCGTTCTGGG - Intergenic
1145908915 17:28531612-28531634 GGGTCTGTGCTGGAGGGTCTAGG - Intronic
1148240436 17:45996558-45996580 GGCTGTCTGCAGGCGGCTCTTGG - Exonic
1148439894 17:47706508-47706530 GGGTCTCAGCAGCAGCTTCTGGG + Intronic
1149431157 17:56596249-56596271 GGCCCTCGGCCGGAGGTGCTGGG + Intergenic
1150262084 17:63801981-63802003 GGCTCCCTGAAAGGGGTTCTTGG - Intronic
1151549903 17:74816307-74816329 TGCTCTCTACATGAGGTTCCTGG - Intronic
1152328384 17:79655989-79656011 GGGTCCCTGCAGAAGGCTCTGGG - Intergenic
1152478290 17:80532787-80532809 GGCTCTCTGCAGGGGGTAAAAGG + Intergenic
1153197035 18:2611658-2611680 GGCTCTGTGCAGCAGGTTGGAGG - Intronic
1153478882 18:5527275-5527297 TGCTGACTGCAGGAGCTTCTTGG - Intronic
1155066460 18:22273420-22273442 GGCTCTTACCTGGAGGTTCTGGG + Intergenic
1157327825 18:46681548-46681570 GGCTGTGTCCAGGAGGTACTGGG - Intronic
1158947497 18:62459598-62459620 GGCTCTCTGCAGGGGCTGCTGGG + Intergenic
1159625838 18:70692902-70692924 AGCTCTGAGAAGGAGGTTCTAGG + Intergenic
1159642063 18:70875374-70875396 GGCTCTATGCATTAGGTGCTGGG + Intergenic
1160533982 18:79581403-79581425 GGGTCTAGGCAGGAGCTTCTGGG + Intergenic
1160647714 19:201098-201120 GGCTGACTTGAGGAGGTTCTGGG + Intergenic
1160750145 19:730130-730152 GGCTTCCTGCAGGAGGTGCCTGG - Intronic
1160833434 19:1113679-1113701 GTCTCTCTGCAGGAGGCACAGGG + Exonic
1161031672 19:2060618-2060640 GGCACTCTGCAGGTGGGACTGGG + Intergenic
1161124770 19:2549664-2549686 GTGTCTCTCCAGAAGGTTCTGGG - Intronic
1161282731 19:3454512-3454534 TGCTCTCTGGATGTGGTTCTGGG + Intronic
1161290477 19:3491222-3491244 GGGACTCTGCGGGAGGCTCTGGG - Exonic
1161628644 19:5340407-5340429 GGCGCTCGGCAGGGGGTGCTGGG - Intronic
1166089225 19:40497530-40497552 GGCTCTCTGCAGGTTGTAGTTGG - Exonic
1166965773 19:46528680-46528702 GGCTTTCTGCGGGAGGCTCTGGG - Intronic
1167482224 19:49740073-49740095 GTCTGTCAGCAGTAGGTTCTTGG + Exonic
1168678108 19:58293747-58293769 GTTTCTCTTCGGGAGGTTCTGGG - Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925306424 2:2850510-2850532 GGCTCTCTGCAGGGGGCAGTGGG - Intergenic
926219098 2:10923306-10923328 GGCTATCTGCAGGGGGCTTTGGG - Intergenic
926324314 2:11771256-11771278 GGCCCTCCCCAGGAGGTGCTTGG + Intronic
927880724 2:26688267-26688289 GGCTTTCTGCAGCAGCTTCTGGG + Intergenic
928120242 2:28578713-28578735 GGCTTTTTGCAGGGGTTTCTAGG + Intronic
928728353 2:34202173-34202195 GGCTCTCTGCAGGTTCCTCTGGG - Intergenic
930066950 2:47334928-47334950 GGATCTCTGAGGGAGGTTTTGGG + Intergenic
930406457 2:50962982-50963004 GTCTCTCTGAAGTAGGTTATAGG + Intronic
933741477 2:85538018-85538040 GGGTCTCTGCAGCCTGTTCTGGG - Intergenic
934664222 2:96158617-96158639 GGCTCCATGCAGCAGGTGCTGGG + Intergenic
935470601 2:103455311-103455333 TGCTCTCTGCAGGTGGTACAAGG + Intergenic
935541910 2:104358511-104358533 GGCTGTCTTCTGGAGCTTCTTGG - Intergenic
936656495 2:114494194-114494216 GGCTCTCTGCAGTGTGATCTTGG + Intronic
938247677 2:129791714-129791736 GTCTCTATGCACGAGGTGCTGGG - Intergenic
938614625 2:132984377-132984399 GGCCCTCTGGAGCAGTTTCTGGG - Intronic
938768136 2:134477208-134477230 AGCACTATGCAGGAGGTACTGGG + Intronic
939031958 2:137087403-137087425 AGCTTTCTGCAGGAGGCTTTAGG - Intronic
939253257 2:139710796-139710818 TGCTATCTGTTGGAGGTTCTTGG + Intergenic
939696482 2:145331490-145331512 TGCCCTCTGAAGGAGGTGCTGGG - Intergenic
940649678 2:156429343-156429365 TGTTCTCTGCAAGAGTTTCTTGG + Intergenic
941448759 2:165633896-165633918 GGCTTTGTGCAGCAGGGTCTTGG - Intronic
942671175 2:178377683-178377705 GGATCTCTGCGGGAAGTGCTTGG - Intronic
945907834 2:215614822-215614844 GGTCCTCTGCTGGAGCTTCTAGG - Intergenic
946069159 2:217016491-217016513 TTCTCTCTGCTGGAGGTTGTAGG - Intergenic
946156171 2:217808179-217808201 GACCCTCTGCAGGAAGGTCTGGG + Intronic
946956901 2:224940776-224940798 TGCTCTCTGTAGGAGGTGCCTGG + Intronic
947524224 2:230868695-230868717 GGCCCTCGGCAGGAGGAGCTGGG + Intronic
948804867 2:240449172-240449194 GGCTGTCAGCAGGAGGTTTAAGG - Intronic
1169388915 20:5173717-5173739 GGCTCTCTGCAGGCTCTTCCAGG - Intronic
1169426033 20:5497978-5498000 GGTTTCTTGCAGGAGGTTCTGGG - Intergenic
1169575602 20:6956716-6956738 GACTCTCTGCAGAAGGTGTTTGG - Intergenic
1170617364 20:17964931-17964953 GGTTTTCTTCAGCAGGTTCTGGG - Intronic
1171292446 20:23990073-23990095 GGACCTCTGCAGCAGGTGCTAGG - Intergenic
1172475726 20:35236033-35236055 GGCGCTCTGCAGAATGTCCTTGG - Intronic
1173620000 20:44429574-44429596 GGCTCCCGGCAGGAGCTTATAGG - Exonic
1174681819 20:52415882-52415904 GACTCTCTGAAGGAGGGTCCTGG + Intergenic
1175791148 20:61740613-61740635 GCCTCTCTCCAGGAGGGTGTGGG + Intronic
1178040786 21:28638762-28638784 GGCTGTCTGCCGGAGCTCCTTGG + Intergenic
1178321437 21:31609169-31609191 GACTTACTGCAGGAGGATCTTGG + Intergenic
1179287165 21:39987333-39987355 GGCTTTCTGGAAGAGGTTTTGGG + Intergenic
1179485839 21:41710344-41710366 GCCTCCCTGAAGGAGGCTCTGGG + Intergenic
1180073481 21:45450213-45450235 GGGTCTCTGCAGGACATTCTGGG + Intronic
1180115462 21:45700791-45700813 AGCTCTCTACAGAAGGCTCTGGG - Intronic
1182031511 22:27162867-27162889 GGCTATCTGGAGGATGTTCTAGG + Intergenic
1183579924 22:38718087-38718109 GGCTCTCTGCCTGAGGCTTTTGG + Intronic
1185233006 22:49694075-49694097 GGTTCTGAGCAGGAGGATCTGGG + Intergenic
1185384811 22:50526777-50526799 GGCCTTCTGCAGCCGGTTCTTGG + Intronic
950143645 3:10632726-10632748 GGTCCTCTGCAGGTGGCTCTGGG + Intronic
951520563 3:23607078-23607100 GACTCCCTGCTGGAGGATCTTGG - Intergenic
951977138 3:28524541-28524563 GACTGCCTGCAGGAGCTTCTGGG - Exonic
952156320 3:30647397-30647419 AGTTCTGTGCAGGAGGTTTTTGG - Intronic
954429403 3:50461960-50461982 GGCTCTGGGCAGGACTTTCTTGG + Intronic
955109878 3:55937920-55937942 GGCTCCCTGCATGTGTTTCTAGG - Intronic
957585063 3:82122600-82122622 TGATCTCTGAAGAAGGTTCTGGG - Intergenic
959802192 3:110508651-110508673 AGCTCTCTGCAGGAGTCTTTAGG + Intergenic
961473991 3:127135778-127135800 GGCTTTCTCCAGGAGCTGCTAGG + Intergenic
961646567 3:128395845-128395867 GGCTCTCTCCAGGAAGCGCTTGG - Intronic
962218180 3:133540921-133540943 GGCTGTCAGCAGGAGAGTCTTGG - Intergenic
964537840 3:157744475-157744497 GGCTTTCTGGAGGAGTTTTTAGG + Intergenic
965557701 3:170035104-170035126 GCCTCTCTCCAGGCGGATCTGGG - Intergenic
965614196 3:170576466-170576488 GGCTTTTTGTAGGAGCTTCTGGG + Intronic
968370133 3:198219017-198219039 GGCTGACTTGAGGAGGTTCTGGG - Intergenic
968415820 4:432772-432794 TGCTCTCTGCTGGAGGACCTCGG - Intronic
968605861 4:1534999-1535021 TGCTCCCTGGAGGAGGTTCTAGG - Intergenic
969543120 4:7806327-7806349 GGCTCTCTGCAGGTGCTTGCCGG - Intronic
975551248 4:75615265-75615287 GACTATTTGTAGGAGGTTCTGGG - Intronic
976000305 4:80366522-80366544 GGCTCTGTGCTGTAGGCTCTGGG + Intronic
985552300 5:539886-539908 GGCTCCCTGCAGCGGGTCCTGGG + Intergenic
985836412 5:2275349-2275371 CTCTCTCTGCAGGAGGCTGTGGG - Intergenic
986005166 5:3661399-3661421 AGCTCTCTGAAGACGGTTCTAGG - Intergenic
986192130 5:5507423-5507445 GGCTGACTGCAGCAGGTGCTGGG + Intergenic
986218158 5:5740515-5740537 GGAACTCTGCATGAGGTCCTAGG + Intergenic
986617058 5:9628499-9628521 GGCTCTCTGCAGGATGAAGTAGG + Intergenic
988610782 5:32722640-32722662 GGATGTCTCCAGGAGGTTCCGGG - Intronic
989098824 5:37806046-37806068 GTTTCTCTGCAGAATGTTCTCGG - Intergenic
990492166 5:56313153-56313175 GGCACTTTGGAGGAGGTGCTGGG - Intergenic
993593331 5:89823196-89823218 TCCTCTCTGTAGGAGGCTCTGGG - Intergenic
994087671 5:95778169-95778191 GGGTATCTGCAGGAGGTCCTTGG - Intronic
995385670 5:111586199-111586221 GGTTCTCTGCAGCAGATTATGGG + Intergenic
996525340 5:124473388-124473410 TGCTCACTGCAGGAGGTCCTAGG + Intergenic
997666171 5:135631064-135631086 GGCTTTCTGCTGGAAGTTCAGGG - Intergenic
999046790 5:148478349-148478371 TGGATTCTGCAGGAGGTTCTGGG + Intronic
999119540 5:149198466-149198488 GGCTTTTTCCAGGAAGTTCTGGG + Intronic
999998638 5:157116559-157116581 GGGCCTCTGTAGGAGGTTGTGGG - Intronic
1001308778 5:170595502-170595524 GGCTCCCTGCAGGACCCTCTGGG + Intronic
1001797734 5:174516006-174516028 GGCTCTCTGCAGAAAGGTGTTGG - Intergenic
1003084352 6:3049536-3049558 GGATGTCTGCAGGAGCTTCTTGG + Intergenic
1003517650 6:6831058-6831080 GGCCCTCTGCAGGAGTTTCCAGG - Intergenic
1004169173 6:13282560-13282582 GGCCCTCTGCAAGAAGTTCAAGG - Intronic
1012139033 6:95598342-95598364 GGGTCTCTGAAGGAGGTTACAGG + Intronic
1013233901 6:108180016-108180038 CGCTCTCTAGAGGAGCTTCTAGG + Intronic
1018939258 6:168297527-168297549 GGCTGACTCCCGGAGGTTCTAGG - Intronic
1019520453 7:1458569-1458591 GTCTCTCCCCAGGAGGGTCTTGG - Intronic
1019565981 7:1679344-1679366 CCCTCCCTGCAGGAGGCTCTGGG + Intergenic
1019893507 7:3965599-3965621 GGCACTCTGGATGAGGCTCTGGG + Intronic
1022850552 7:34257263-34257285 GGGTCTCTGCAGCAGCTTCTGGG - Intergenic
1023150054 7:37193544-37193566 GGCTCCCTGCAGGAGCTTAGAGG + Intronic
1025810378 7:64871824-64871846 TGCACTTTGCAGGAGGCTCTTGG + Intronic
1026850509 7:73720377-73720399 GGAACTCTCCAGGAGGTTTTTGG - Intergenic
1027531405 7:79338570-79338592 GTCTCTCTGGATGAGCTTCTGGG + Intronic
1029639741 7:101813589-101813611 TGCTCTCTGCAGGGGGTGGTGGG - Intergenic
1030267193 7:107632506-107632528 GGTTCCCTTCAGGAGCTTCTAGG + Intergenic
1033249022 7:139743024-139743046 GGCTCTCTGGAGGACAGTCTAGG + Intronic
1034278435 7:149834879-149834901 GGCTCTTTGCAGGAGGAACAGGG - Intergenic
1034672824 7:152870899-152870921 GGGTCTCTGCAGCAGGATCTGGG + Intergenic
1034672836 7:152870951-152870973 GGGTCTCTGCAGCAGGATCTGGG + Intergenic
1034672848 7:152871003-152871025 GGGTCTCTGCAGCAGGATCTGGG + Intergenic
1034672860 7:152871055-152871077 GGGTCTCTGCAGCAGGATCTGGG + Intergenic
1035257897 7:157643687-157643709 GGGTGTCTGCAGGGGGTCCTTGG - Intronic
1036286007 8:7444743-7444765 GTCTACCTGCAGGAGGTGCTTGG + Intronic
1036335466 8:7866786-7866808 GTCTACCTGCAGGAGGTGCTTGG - Intronic
1036453632 8:8890950-8890972 GGCACTCTGCAGTCGGTCCTCGG + Exonic
1038394621 8:27237699-27237721 GCCCATCTGCAGGAGGATCTTGG + Intronic
1040530254 8:48260864-48260886 GGCCTTGTGCAGTAGGTTCTCGG - Intergenic
1040817476 8:51524023-51524045 GGGCCTCTGCAGCAGGATCTGGG + Intronic
1042369098 8:67970532-67970554 GAATCTCTGTAGGAGGTTGTTGG - Intronic
1043926988 8:86048588-86048610 GGCCCTCTGCATGAGGTTTCGGG + Exonic
1047737497 8:127779314-127779336 GTCTCTCTGGAGGAGATTTTGGG + Intergenic
1048797646 8:138166205-138166227 GGCTCTGTGCTGGAGGTTTTGGG - Intronic
1049716649 8:144096048-144096070 GGCTGGCAGCGGGAGGTTCTGGG + Intronic
1050306480 9:4310691-4310713 GGCTCATTGTAGGAGGTCCTTGG - Intronic
1055064125 9:72101467-72101489 GGCTCCCTCCAGGTGGATCTAGG - Intergenic
1056036235 9:82608972-82608994 GCATTTCTTCAGGAGGTTCTAGG + Intergenic
1056137319 9:83642986-83643008 GGTCCTCTGCAGGATGTTCAGGG - Intronic
1056684980 9:88752038-88752060 GGCTCCCCGCAGGAGCCTCTGGG - Intergenic
1059438240 9:114289062-114289084 CCCTCCCTGCAGGAGGGTCTGGG + Intronic
1059453427 9:114385286-114385308 GGCTCTCTGCAGGTTGTTTCAGG - Intronic
1060051353 9:120380596-120380618 GACTCTCTGGAGGAAGTCCTTGG + Intergenic
1060405671 9:123371855-123371877 GCCTTTCTGCAGGAGCTACTTGG + Intronic
1060652549 9:125341314-125341336 GGCTCTCTGAAAGAGATTCTGGG - Intronic
1061238042 9:129353290-129353312 GGCCCTCTCCAGGAGGGACTGGG + Intergenic
1061768069 9:132895161-132895183 GCCTCACTGTAGCAGGTTCTAGG - Exonic
1061874460 9:133536932-133536954 GGCTCTGGGCAGAAGTTTCTAGG - Intronic
1061949182 9:133926676-133926698 GGCTTCCTGGAGGAGGTGCTGGG - Intronic
1062413977 9:136438895-136438917 GTCTCTGTGCGGGAGGTTCGGGG + Exonic
1062754073 9:138278287-138278309 GGCTGACTTGAGGAGGTTCTGGG - Intergenic
1203782982 EBV:111236-111258 GGGTCTCTCGAGGGGGTTCTGGG + Intergenic
1185829280 X:3284154-3284176 GACTCTCTGCAGGAGGATCAAGG + Exonic
1186666408 X:11721635-11721657 GGATCTCTGCAGGAGCTTTTTGG - Intergenic
1187672573 X:21683314-21683336 TGCTCTTTGCAGGCGGCTCTGGG - Intergenic
1193873307 X:86828967-86828989 GGCTTTTTGCAGGAGATGCTTGG - Intronic
1199924761 X:152450800-152450822 GGCTTTCTGCAGCAGCTGCTGGG + Intronic
1200964870 Y:9026674-9026696 TGCACTTTGCAGGAGGCTCTAGG - Intergenic