ID: 915907757

View in Genome Browser
Species Human (GRCh38)
Location 1:159891304-159891326
Sequence ACTCTTACAATCTTTGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915907756_915907757 14 Left 915907756 1:159891267-159891289 CCACACAGTGGGTTTGAAGCAAT 0: 1
1: 0
2: 1
3: 16
4: 128
Right 915907757 1:159891304-159891326 ACTCTTACAATCTTTGATATTGG 0: 1
1: 0
2: 1
3: 15
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915907757 Original CRISPR ACTCTTACAATCTTTGATAT TGG Intronic
901663458 1:10813293-10813315 ACTCTGACCATCTATGAAATGGG - Intergenic
902260010 1:15217852-15217874 ACTCTCACAGTGTTTAATATGGG + Intronic
903879362 1:26498538-26498560 ACTCTTGCAATCTCTGTCATTGG - Intergenic
904240653 1:29142531-29142553 ACTCTGACAGTCTTTTATTTAGG + Intergenic
907741227 1:57168011-57168033 ACTTTTACAATCTCTGCTAGGGG - Intronic
908567406 1:65371383-65371405 ACTCTTAGAATTTTTTTTATAGG + Intronic
911757740 1:101579487-101579509 ACTCTTTAAATGTTTGATTTTGG - Intergenic
911805063 1:102195446-102195468 ACTCCTACAATGTGTGACATAGG - Intergenic
915907757 1:159891304-159891326 ACTCTTACAATCTTTGATATTGG + Intronic
917318449 1:173753917-173753939 AATCTTACAATCTGTCAAATTGG - Intronic
917745400 1:178001731-178001753 TCTCTTACAATATTTGCTTTTGG + Intergenic
918978457 1:191523266-191523288 ATTCTGAACATCTTTGATATTGG - Intergenic
919303833 1:195804431-195804453 CATCTTACAATCTTTTATACGGG + Intergenic
921022831 1:211252122-211252144 TCTTTTACACTCTTTAATATTGG + Intergenic
923838856 1:237645569-237645591 TCTCTTACAATCTATGTTCTTGG - Intronic
923868827 1:237968909-237968931 AGTCTTACAAGCTTTTTTATTGG + Intergenic
1063764304 10:9120456-9120478 CCTCTCACAGTCTTTGATAATGG + Intergenic
1063820968 10:9835150-9835172 ACTCTTAAAATTTTATATATGGG + Intergenic
1064628655 10:17286740-17286762 ACTCTAACAATCTTTGCTCCAGG - Intergenic
1065395675 10:25234568-25234590 ACTCTTCAAATTTTTCATATTGG + Intronic
1066018328 10:31270767-31270789 AATCTTACAATGTTTGTTCTGGG + Intergenic
1070028381 10:72653627-72653649 ACTCTTTCAATCTCTGTTACAGG + Intergenic
1073003528 10:100303482-100303504 ACTTTTAAAATGTTTGATGTGGG - Intronic
1079632324 11:22693098-22693120 TATTTTACAATATTTGATATTGG - Intronic
1081021080 11:37948243-37948265 ACTTTTACAATCTTAGCCATAGG - Intergenic
1082122825 11:48397760-48397782 AGTCTTACAGTCTTTGCTAAGGG - Intergenic
1082251841 11:49991213-49991235 AGTCTTACAGTCTTTGCTAAGGG + Intergenic
1086297839 11:85390822-85390844 TCTTTTACACTTTTTGATATAGG - Intronic
1088011600 11:105008440-105008462 AGTCTTACCATCTATGAAATGGG - Intronic
1090688468 11:129151752-129151774 ACTCTTAGCCTTTTTGATATGGG - Intronic
1093153054 12:15646570-15646592 ACTCTTAAAAAATTTAATATAGG - Intronic
1093719558 12:22423742-22423764 AATCTGACAATCTTTGTTTTAGG + Intronic
1093720054 12:22430382-22430404 AATCTGACAATCTTTGTTTTAGG + Intronic
1093987832 12:25557048-25557070 ACTCTTTGAATCTTAGATAATGG - Intronic
1096300413 12:50422486-50422508 AATCTTAAAATATTTGATGTAGG + Intronic
1096924709 12:55130938-55130960 ATTCTGAAAATCTTGGATATTGG + Intergenic
1097198410 12:57257912-57257934 ACTCTTTCAATCTCTGCAATTGG + Intronic
1097600924 12:61692587-61692609 ATTCTTTCAATCTTTGAAATGGG - Intergenic
1098700444 12:73617446-73617468 AATTTTTCAATATTTGATATTGG - Intergenic
1098734179 12:74077423-74077445 ATTCTTAGAATCTTAGTTATAGG - Intergenic
1100910418 12:99354845-99354867 ACTCAAACAATCTTTGGGATAGG + Intronic
1101089038 12:101266103-101266125 ACTATTACAATCATTGATAGAGG + Intergenic
1101685285 12:107013582-107013604 ACAATTACAATTTTTGATACAGG - Intronic
1102763013 12:115405573-115405595 ACTCTTTCCATCTTTAAAATGGG + Intergenic
1103180657 12:118908485-118908507 TCTTTTCCAATCCTTGATATGGG - Intergenic
1107828055 13:44348280-44348302 ACTCTTACAAAGTTAAATATAGG + Intergenic
1109612955 13:64790761-64790783 ACTCTTACAATCTGTGAACTTGG - Intergenic
1111724666 13:91991452-91991474 ACTAGTACTATCTTTCATATGGG + Intronic
1112247983 13:97751902-97751924 ACTCTTTCCATCTTGGAGATTGG - Intergenic
1119646709 14:76353650-76353672 GCCCTTACAATCTGTGATCTTGG - Intronic
1119885505 14:78137276-78137298 GCTCTCACAATCCTTGAGATTGG + Intergenic
1120352341 14:83378701-83378723 ACTCTGACATTATTTGATTTAGG - Intergenic
1120458928 14:84768434-84768456 ACACTTACATTCTGAGATATTGG - Intergenic
1122333748 14:100951158-100951180 ACTCATACAATTTTTGTAATTGG - Intergenic
1124615985 15:31242515-31242537 ACTCTTAAAATCTTTGATGGTGG + Intergenic
1124697137 15:31873221-31873243 CCTCTTTCATTTTTTGATATTGG + Intergenic
1125290981 15:38146540-38146562 ACCCCTAGAATCTTTGATGTTGG + Intergenic
1126233945 15:46360009-46360031 TCTTTTACATTCTTTGTTATAGG + Intergenic
1126812717 15:52423907-52423929 GCTCTTACCATCTTTGTTACTGG - Intronic
1130162787 15:81418379-81418401 ACTGTTACATTCTGAGATATTGG - Intergenic
1131217660 15:90552625-90552647 ACTCTTTTAATCTATGATTTGGG + Intronic
1137820786 16:51443518-51443540 CCTGTTACAATCTTTGCCATTGG - Intergenic
1138483789 16:57322280-57322302 AATCTTCCAATCTATGATTTTGG - Intergenic
1138662848 16:58534840-58534862 AGTTTTAAAATCTTTGTTATTGG - Intronic
1140682368 16:77397976-77397998 ACCCTTACCATCCTTTATATTGG - Intronic
1150520154 17:65858200-65858222 AATATTACAATCTTTTAAATTGG + Intronic
1155380599 18:25218159-25218181 ACACTTACAATGTTTCAAATAGG + Intronic
1155776789 18:29774343-29774365 ATTCTTACAATCATTTATATTGG - Intergenic
1156435700 18:37126630-37126652 TTTCTTATAATCTTTGATTTTGG - Intronic
1156564216 18:38165276-38165298 ACTAATACAAACTTTGATAATGG - Intergenic
1157538991 18:48485788-48485810 ACTCTTAGAATCCTTGCTTTTGG + Intergenic
1157917042 18:51674783-51674805 CCTCTTTCAATCTTTGATAGAGG + Intergenic
1158079656 18:53574859-53574881 CCAATTACAATTTTTGATATTGG - Intergenic
1158808977 18:61008999-61009021 ACTGTTACAATTGTTTATATTGG - Intergenic
1159486506 18:69065957-69065979 CCTCTTCCAATATTTGAGATTGG - Intergenic
1162048291 19:8016159-8016181 ACTTTTACAATCTTTGGAACCGG + Intronic
1163883277 19:19945511-19945533 ATACGTACATTCTTTGATATAGG - Intergenic
927076882 2:19587533-19587555 CCTCCTCCAATCTTTGAGATAGG - Intergenic
931521913 2:63106799-63106821 ACTCTTACAATCCTAGCTAGAGG - Intergenic
942910672 2:181240108-181240130 ACTATTACTATTTTTGAGATTGG + Intergenic
942946011 2:181674425-181674447 ACTCTTACAGTTTTTGTAATTGG - Intronic
942986151 2:182144811-182144833 ACTCTTCCAATTTTTCCTATTGG - Intronic
943053849 2:182950773-182950795 TCACTTACAAGCTTTGATTTCGG - Intronic
943294752 2:186123249-186123271 ACTCTTTCAATCTGTGAGCTTGG - Intergenic
943511753 2:188835515-188835537 ACACTTACAGTCTTTGCTACTGG + Intergenic
944535503 2:200705651-200705673 ACCCTGACAACCTTTGATCTGGG - Intergenic
945579250 2:211572346-211572368 ACGCTAACAATCTGTGACATTGG + Intronic
947005508 2:225506744-225506766 ACTCTTGGAATCTTTCATGTGGG - Intronic
947144037 2:227047904-227047926 ACAGTTACAATTTTTGATTTTGG - Intronic
1169649997 20:7856424-7856446 TCTCTTCCAAGCTTTGCTATAGG - Intergenic
1171948231 20:31397317-31397339 ACCCTTACAATTTTTTATTTGGG - Intergenic
1173022555 20:39279173-39279195 ACTATTACTATCTTTGTTAGAGG + Intergenic
1174028433 20:47599666-47599688 AATCTAACAATGTTTGAGATAGG - Intronic
1176737228 21:10561737-10561759 ACTTTTACAGTTTTTGATCTAGG + Intronic
1178129706 21:29558175-29558197 ACTCTGCCAATCTTTGATTATGG + Intronic
1180563230 22:16639288-16639310 ACTTTTACAGTTTTTGATCTAGG + Intergenic
1182046060 22:27275040-27275062 ACTCTTACAGTCCTTGCTATGGG + Intergenic
1183236295 22:36621024-36621046 ACTCTTACATTGTATGAGATGGG + Intronic
1183531898 22:38360856-38360878 ACTTTTACAGTTTTTGATCTAGG - Intronic
949280534 3:2341641-2341663 ACTTTTACAATCTGTGGTAGAGG - Intronic
950145371 3:10646123-10646145 GCTCTCACAAACATTGATATCGG - Intronic
951797940 3:26562586-26562608 ACTCTGTCAAACTTTGATCTTGG + Intergenic
955672548 3:61417179-61417201 ACTCTTAGAATCTATAACATAGG + Intergenic
957970982 3:87381517-87381539 ACTCTTAGAATCTTTAAACTGGG + Intergenic
958530186 3:95319637-95319659 ACTCTTAGAAACTGTGAGATAGG - Intergenic
959059256 3:101601231-101601253 ACTCTTTCCTTTTTTGATATAGG + Intergenic
959278931 3:104311952-104311974 ACTCTTACAATCCTAGGTATGGG - Intergenic
959547052 3:107608678-107608700 ATTCTTACAATCTTTGAACATGG + Intronic
960514050 3:118583275-118583297 AATCATACCATTTTTGATATGGG - Intergenic
960765453 3:121124928-121124950 ACTCTTAGAATATTGGAAATAGG - Intronic
960842589 3:121975323-121975345 ACTATTATAATCTTTGTTTTGGG + Intergenic
962592782 3:136907501-136907523 ACTCTTACAATCCTAGCCATGGG - Intronic
963547138 3:146673505-146673527 AATCTAACAATCATTAATATTGG - Intergenic
963731087 3:148973300-148973322 AGTCTTATCATCTTTAATATGGG - Intergenic
965026575 3:163309808-163309830 TCTCTTACAATCATTGATTTTGG - Intergenic
967566196 3:190976254-190976276 CCTTTTACATTTTTTGATATTGG + Intergenic
970148325 4:13060740-13060762 ATTCTTCCAATCTATGATAATGG + Intergenic
971296195 4:25395050-25395072 ACTCTTTCAATCTTGGGTATAGG - Intronic
972053334 4:34768715-34768737 TCTCTTAAAATGTTTGATTTTGG - Intergenic
972567974 4:40285910-40285932 ACTCTTACAATCCTGGCTCTGGG + Intergenic
972955375 4:44383194-44383216 ATTCTTACAATCTATGATCATGG - Intronic
975078722 4:70248108-70248130 ACTCTTTCAACATTTCATATTGG + Intronic
981290549 4:143070522-143070544 ATTCTTAGACTCTTTGATTTGGG + Intergenic
982501100 4:156156160-156156182 ATTCTGACAATCTTTTTTATTGG - Intergenic
983450974 4:167910875-167910897 ACTCTCACAATTTTTCATTTTGG + Intergenic
985120564 4:186636865-186636887 ACTCTTGCAATGGTTGATTTGGG + Exonic
987414211 5:17646377-17646399 GCTCTTTCAGTCTTTGATGTAGG + Intergenic
988434764 5:31161056-31161078 ACTCTTACAATATTACAAATGGG + Intergenic
989112673 5:37922251-37922273 ACTGTTACATGCTTAGATATAGG + Intergenic
990999982 5:61772889-61772911 ACTCTTACAATCTTTATTAATGG + Intergenic
992924822 5:81571702-81571724 ACTCTTAGAATCTTTATTCTGGG - Intronic
993155500 5:84217099-84217121 ACTCTTATAATATTTAACATTGG + Intronic
994995893 5:107062384-107062406 ACTCTTTCAATAGTTAATATTGG - Intergenic
995432946 5:112102257-112102279 ACCCTAATAATCTTTGATAGTGG - Intergenic
998088993 5:139350789-139350811 CCTCTTTCAGTTTTTGATATTGG + Intronic
998812269 5:145978252-145978274 ACTCTTATAATCTTAGGTTTGGG - Intronic
1000154493 5:158537267-158537289 ACTATCACCATCTTTGTTATTGG - Intergenic
1000238657 5:159387913-159387935 ACTATTACAATCTTGGCTATGGG - Intergenic
1004576643 6:16902402-16902424 AATCTTACTTTCTTTCATATGGG + Intergenic
1005664806 6:28041740-28041762 TAACTTACAATCTTTGAGATAGG - Intergenic
1010341439 6:74757846-74757868 ACACTCAGAATCTTTAATATAGG + Intergenic
1012176854 6:96097638-96097660 ACAAATAAAATCTTTGATATAGG + Intronic
1012732021 6:102895322-102895344 AATCTTACAATCTTACATCTTGG - Intergenic
1014170675 6:118275666-118275688 ATTCTTACAATTTTTGTTCTTGG + Intronic
1014900525 6:126958422-126958444 ACAATTCCAATCTTTGATTTGGG + Intergenic
1015175972 6:130309510-130309532 GCTTTTAAAATCATTGATATCGG + Intronic
1017311642 6:152983064-152983086 ACTTTTAAAATCTTTGAATTTGG + Intronic
1021154555 7:17194243-17194265 ATTATTACATTCTTTGAAATTGG + Intergenic
1021878743 7:25073338-25073360 ACTTTGACAGTCTTTGATTTAGG + Intergenic
1023334660 7:39155891-39155913 ACTATTACATTGTTTAATATGGG - Intronic
1031150194 7:118045336-118045358 ATGCAGACAATCTTTGATATAGG + Intergenic
1031281210 7:119802140-119802162 CCTCCTACAATCTTTAAAATAGG - Intergenic
1031755375 7:125634733-125634755 ACACTTACATTCTTAGTTATTGG - Intergenic
1032691447 7:134291288-134291310 ATTCTTACAAGCATTGATATTGG - Exonic
1033925274 7:146451321-146451343 ACTCTTAAAATCTCTGTTATTGG - Intronic
1034764721 7:153709190-153709212 AGTTTGCCAATCTTTGATATAGG - Intergenic
1037216963 8:16466660-16466682 ACTCTCACATTCTTTGTTATTGG - Intronic
1040118466 8:43652592-43652614 ACTCTTTCTATTTTTTATATGGG - Intergenic
1041305972 8:56461232-56461254 ACTCTCTCCATCTTTGTTATTGG + Intergenic
1042633158 8:70843703-70843725 ACTCTTACAATCTTACCCATGGG + Intergenic
1042793565 8:72635302-72635324 ACTCTTAAATCCTTTGATCTTGG - Intronic
1043129585 8:76444372-76444394 AATCTTTGAATCTTTTATATGGG - Intergenic
1043178380 8:77051345-77051367 ACTATTACAATCTGTGAAAACGG + Intergenic
1043837272 8:85062275-85062297 CCTCTTACAATGTTTAAAATTGG - Intergenic
1044734400 8:95264714-95264736 ACTCTGACAATTTTTAACATAGG + Intronic
1045888205 8:107124145-107124167 ACTCATACATTCTCTGATGTCGG - Intergenic
1046073421 8:109286486-109286508 CATCTGACAATCTTTGATAAAGG + Intronic
1046390302 8:113563540-113563562 ATTGTCACAATCTTTCATATTGG + Intergenic
1051286177 9:15499282-15499304 ACTCTTACAAGCTTTGACATTGG - Intronic
1188063803 X:25633107-25633129 ACTCTTGTAATCTTAGTTATGGG + Intergenic
1188942610 X:36259514-36259536 CCTCTAACAGTATTTGATATAGG + Intronic
1189046584 X:37598961-37598983 AATCTTAACATCTTTGAAATTGG - Intronic
1190892827 X:54586244-54586266 ACTCCTACAATCCTAGCTATGGG + Intergenic
1191929871 X:66359867-66359889 AGTTTTAAAATCTTTAATATTGG - Intergenic
1193636029 X:83949561-83949583 ACTGTTACAATCCTAGCTATGGG - Intergenic
1194458338 X:94132720-94132742 ACTAATACAAATTTTGATATTGG + Intergenic
1195130652 X:101847635-101847657 ACTGTTACTATCTTTGAGTTAGG - Intronic
1195175603 X:102312611-102312633 ACTGTTACTATCTTTGAGTTAGG + Intronic
1195183261 X:102374482-102374504 ACTGTTACTATCTTTGAGTTAGG - Intronic
1195376213 X:104230626-104230648 AATCTTCCAATCTTTAATGTTGG - Intergenic
1195805033 X:108755449-108755471 ACTTTTAACATCTTTTATATTGG - Intergenic
1197491576 X:127123056-127123078 ATTCTTCCAATCTTTGATCATGG - Intergenic
1199537929 X:148924740-148924762 ACTCTTACAATGTTAGAATTAGG + Intronic
1200319758 X:155175393-155175415 ACTCTTTCATTTCTTGATATTGG + Intergenic
1201619197 Y:15936591-15936613 AATCTTAACATCTTTGATAAAGG - Intergenic